Báo cáo y học: "Critical role of hnRNP A1 in HTLV-1 replication in human transformed T lymphocytes" pdf

Báo cáo y học: "Critical role of hnRNP A1 in HTLV-1 replication in human transformed T lymphocytes" pdf

Báo cáo y học: "Critical role of hnRNP A1 in HTLV-1 replication in human transformed T lymphocytes" pdf

... regulation of HTLV-1 gene expression, by interfering with the binding of Rex to the XRE [12]. In the present study, we first dem- onstrate that the mutation of a putative binding site of hnRNP A1 to ... directly or indirectly impli- cated in down-modulating the post-transcriptional activ- ity of Rex. Since the mutations affect a putative binding site for hnRNP A1, these...

Ngày tải lên: 13/08/2014, 13:20

13 282 0
Báo cáo y học: "Critical role of the major histocompatibility complex and IL-10 in matrilin-1-induced relapsing polychondritis in mice" doc

Báo cáo y học: "Critical role of the major histocompatibility complex and IL-10 in matrilin-1-induced relapsing polychondritis in mice" doc

... cartilage. Staining with hematoxylin and erythrosine. Original magnification ×200. Figure 3 Titers of antibodies to matrilin-1 in mice immunized with matrilin-1Titers of antibodies to matrilin-1 in mice ... important at the induction of MIRP In order to define the infiltrating inflammatory cells in the acute and chronic phases of murine MIRP, we stained tis- sue sections diss...

Ngày tải lên: 09/08/2014, 01:24

8 541 0
Báo cáo y học: "Synergistic role of c-Myc and ERK1/2 in the mitogenic response to TGF-1 in cultured rat nucleus pulposus cells" ppsx

Báo cáo y học: "Synergistic role of c-Myc and ERK1/2 in the mitogenic response to TGF-1 in cultured rat nucleus pulposus cells" ppsx

... to elucidate a specific regulatory pathway of TGF1. Introduction Transforming growth factor 1 (TGF1) is known to be a potent inhibitor of proliferation in most cell types, including keratinocytes ... status of these mediators in the target cells. Competing interests The authors declare that they have no competing interests. Authors' contributions TN and DS conceived of the...

Ngày tải lên: 09/08/2014, 01:22

12 535 0
Báo cáo y học: "The role of mast cells and fibre type in ischaemia reperfusion injury of murine skeletal muscles" pot

Báo cáo y học: "The role of mast cells and fibre type in ischaemia reperfusion injury of murine skeletal muscles" pot

... exhibit different susceptibilities. The relative degree of mast cell mediated injury, within different muscle types, is not known. Methods: In this study we compared susceptibility of the fast-twitch, ... purposes) gastrocnemius and the fast-twitch EDL muscles. We also demonstrate that muscle fibre type, and mouse strain independently, determined susceptibility to IR injury. The suscept...

Ngày tải lên: 11/08/2014, 08:21

7 400 0
Báo cáo y học: "The role of F1 ATP synthase beta subunit in WSSV infection in the shrimp, Litopenaeus vannamei" potx

Báo cáo y học: "The role of F1 ATP synthase beta subunit in WSSV infection in the shrimp, Litopenaeus vannamei" potx

... the invertebrate prokineticin, astakine, and it is located on the plasma membrane of crayfish Hpt cells [26].It will be interesting to further investigate the precise role of F 1 -ATP synthase ... Using an alternative strategy for the first time in shrimp, Sritunya- laksana et al [8]showed that administration of the host VP28-Binding protein PmRab7 ( or an antibody against it ) coul...

Ngày tải lên: 12/08/2014, 04:20

9 364 0
Báo cáo y học: " The role of cyclin D2 and p21/waf1 in human T-cell leukemia virus type 1 infected cells" potx

Báo cáo y học: " The role of cyclin D2 and p21/waf1 in human T-cell leukemia virus type 1 infected cells" potx

... [28,30]. Tax also has the abil- ity to increase cdk4 associated kinase activity in HTLV-1 infected cells by binding to p16/INK4A, resulting in the inability of p16/INK4A to effectively inhibit cyclin ... cyclins through the C-terminus, making this protein a possible transdominant mutant. Finally, to define an inhibitor that effectively inhibited cyclin D2 associated kinase activity, w...

Ngày tải lên: 13/08/2014, 13:20

17 299 0
Báo cáo y học: "Emerging mechanisms of immune regulation: the extended B7 family and regulatory T cell" pdf

Báo cáo y học: "Emerging mechanisms of immune regulation: the extended B7 family and regulatory T cell" pdf

... APCs. Interestingly, the translocation of CTLA-4 into the synapse is proportional to TCR signal strength [4]. Hence, CTLA-4 might differentially restrict the expansion of T cells on the basis of the ... inflammatory APCs. Finally, B7-H3 and B7x could be important in controlling the interactions between effector T cells and non-APCs in the peripheral tissues. Similarly to the dis...

Ngày tải lên: 09/08/2014, 01:24

7 338 0
Báo cáo khoa học: Critical role of the plasma membrane for expression of mammalian mitochondrial side chain cleavage activity in yeast pptx

Báo cáo khoa học: Critical role of the plasma membrane for expression of mammalian mitochondrial side chain cleavage activity in yeast pptx

... activities in yeast require the use of strains lacking this acetylating activity. For this reason, the CA10 ATF2 gene was disrupted, yielding the strain, CA14. The strain, CA19 was constructed ... activity in yeast. Interestingly, Tgl1p, a potential ester hydrolase, was found to enhance steroid productivity, probably through both the availability and/or the trafficking of the CYP1 1A1...

Ngày tải lên: 08/03/2014, 08:20

13 441 0
Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf

Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf

... CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTAC Reverse CATTTTGTCCGCCAAGACTTTTGAATACTT TCAAGTGC Q76G Forward CTTCCCGGAGGAAATGAGGACTTGGTACTTACTG Reverse CCTCATTTCCTCCGGGAAGACTTTTGAATA C N77G Forward CGGACAAGGTGAGGACTTGGTACTTACTGGATAC Reverse ... contains three domains resembling family 2 cystatins. Cystatins competitively inhibit the activity of papain- like cysteine proteases by binding to the active s...

Ngày tải lên: 17/03/2014, 10:20

10 533 0
Từ khóa:
w