Báo cáo y học: " Human T lymphotropic virus type-1 p30II alters cellular gene expression to selectively enhance signaling pathways that activate T lymphocytes" doc

Báo cáo y học: " Human T lymphotropic virus type-1 p30II alters cellular gene expression to selectively enhance signaling pathways that activate T lymphocytes" doc

Báo cáo y học: " Human T lymphotropic virus type-1 p30II alters cellular gene expression to selectively enhance signaling pathways that activate T lymphocytes" doc

... purposes) Retrovirology Open Access Research Human T lymphotropic virus type-1 p30 II alters cellular gene expression to selectively enhance signaling pathways that activate T lymphocytes Bindhu ... Yamasaki Y, Yamada Y, Tomonaga M, Mori- kawa S, Geleziunas R, Yoshimura T, Yamamoto N: Human T- cell leukemia virus type I tax activates transcription of...

Ngày tải lên: 13/08/2014, 13:20

12 487 0
Báo cáo y học: "Anti-oxidant inhibition of hyaluronan fragment-induced inflammatory gene expression" pps

Báo cáo y học: "Anti-oxidant inhibition of hyaluronan fragment-induced inflammatory gene expression" pps

... turn synergize with the ROS to activate the innate immune sys- tem via TLR-2. Activation of the immune system leads to further production of ROS by activated macrophages, acti- vation of NF-κB and induction ... inhibits KC by up to 83% (p =< 0.0194) (Figure 1A &1B). To demonstrate that the ability of DMSO to inhibit HA-fragment induced cytokine expression was not idiosy...

Ngày tải lên: 11/08/2014, 08:22

10 232 0
Báo cáo y học: "Effects of typical and atypical antipsychotic drugs on gene expression profiles in the liver of schizophrenia subjects" docx

Báo cáo y học: "Effects of typical and atypical antipsychotic drugs on gene expression profiles in the liver of schizophrenia subjects" docx

... acquiring antioxidant activity toward processes with potential implications in apoptosis [51]. Taken together, these results suggest that APs affect the genes associated with mitochondrial func- tion ... so that it is difficult to interpret which AP class affected those genes. In the human liver tis- sues, typical APs and atypical APs may mediate different functions leading to liver...

Ngày tải lên: 11/08/2014, 17:20

15 518 0
Báo cáo y học: "A GA microsatellite in the Fli1 promoter modulates gene expression and is associated with systemic lupus erythematosus patients without nephritis" potx

Báo cáo y học: "A GA microsatellite in the Fli1 promoter modulates gene expression and is associated with systemic lupus erythematosus patients without nephritis" potx

... unaffected control subjects [3]. Based on our results demonstrating that the length of the microsatel- lite is inversely correlated to Fli1 promoter activity and that a shorter microsatellite is ... into Jurkat T cells and assayed for promoter activity. Expression is presented relative to the pGL3 Basic empty vector, which was set to 1. Results are an average of three independen...

Ngày tải lên: 12/08/2014, 15:22

9 268 0
Báo cáo y học: " Inhibition of PP2A by LIS1 increases HIV-1 gene expression" pps

Báo cáo y học: " Inhibition of PP2A by LIS1 increases HIV-1 gene expression" pps

... [1]). Tat binds to a transac- tivation response (TAR) RNA [1] and activates HIV-1 tran- scription by recruiting transcriptional co-activators that include Positive Transcription Elongation Factor ... analyzed the effect of LIS1 on the activity of PP2A in vitro. Our results presented here point to LIS1 as a yet unrecognized regulator of PP2A that may contribute to the regulation of H...

Ngày tải lên: 13/08/2014, 09:20

13 259 0
Báo cáo y học: "Analysis of variation of amplitudes in cell cycle gene expression" potx

Báo cáo y học: "Analysis of variation of amplitudes in cell cycle gene expression" potx

... cell-arresting method on expression of a cell cycle related gene can be quantitatively estimated from the ratio of two estimated amplitudes in two experiments. The ratio can be used to gauge the variation ... and G2/M may be dif- ferentially affected by thy-thy and thy-noc arrests, respectively. Measurements of the intensities of gene expression from microarray experiments are subje...

Ngày tải lên: 13/08/2014, 23:20

8 245 0
Báo cáo y học: "Molecular processes during fat cell development revealed by gene expression profiling and functional annotation" pptx

Báo cáo y học: "Molecular processes during fat cell development revealed by gene expression profiling and functional annotation" pptx

... has different actin-associated cytoskeletal roles. Table 1 Activated metabolic pathways during adipocyte differentiation and their key enzymes (rate limiting steps) Pathway Enzyme/Protein name ... 7 Myoinositol 1-phosphate synthase A1 NP_076116 156 8 Cholesterol biosynthesis/keto-body synthesis 3-hydroxy-3-methylglutaryl-CoA synthase 1 NP_666054 178 4 3-hydroxy-3-methylglutaryl-CoA reductas...

Ngày tải lên: 14/08/2014, 16:20

23 252 0
Báo cáo y học: " Human T-lymphotropic virus type-1 p30 alters cell cycle G2 regulation of T lymphocytes to enhance cell survival" pptx

Báo cáo y học: " Human T-lymphotropic virus type-1 p30 alters cell cycle G2 regulation of T lymphocytes to enhance cell survival" pptx

... K, Lair- more MD: Human T lymphotropic virus type-1 p30II alters cellular gene expression to selectively enhance signaling pathways that activate T lymphocytes. Retrovirology 2004, 1:39. 26. ... against genotoxic insults to HTLV-1 infected lymphocytes. Conclusion: Collectively, our data are the first to indicate that HTLV-1 p30 expression results in...

Ngày tải lên: 13/08/2014, 05:22

15 171 0
Báo cáo y học: " Human T Lymphotropic Virus Type 1 protein Tax reduces histone levels" pot

Báo cáo y học: " Human T Lymphotropic Virus Type 1 protein Tax reduces histone levels" pot

... GCCTTCTTGGCCTTTGCAGCTTTA; H2A Fwd TTCAGTTTCCCGTAGGCCGAGT, H2A Rev GA AGCTTGTTGAGCTCCTCATCGT; H2B Fwd AAGAAGGATGGCAAGAAGCGCAAG; H2B Rev ACTTGGAGCTGGTGTACTTGGTGA; H3 Fwd ATCGCTATCGGCCTGGTACAGT; H3 ... AGCTCAACAAGCTTCTGGGCAA; H2A Rev TTGTGGTGGCTCTCGGTCTTCTT; H2B Fwd TGCGCCCAAGAAGGGTTCTAAA; H2B Rev ACGAAGGAGTTCATGATGCCCA; H3 Fwd TGCTCATCCGCAAACTGCCATT; H3 Rev AGT- GACACGCTTGGCGTGAATA; H4 Fwd ACCG...

Ngày tải lên: 13/08/2014, 06:20

14 269 0
w