Báo cáo y học: " Isolation of suppressor genes that restore retrovirus susceptibility to a virus-resistant cell line" potx

... cDNA insert of the library and the poly (A) addition signal. The amplified DNA from each line was directly cloned into the TOPO plasmid DNA and used to transform bacteria. In this way cloned cDNAs ... by as much as 10 to 100 fold in each round of selection. The protocol should allow the recovery of DNAs that confer susceptibility from any large library, if present at an abundanc...

Ngày tải lên: 13/08/2014, 13:20

... cells, analyzed by FISH. An example of BoHV-4 hybridization signals of symmetrically labelled sister chromatids in the same spread metaphase chromosome is indicated by a white square and enlarged as ... di Parma, Via del Taglio 10, 43100 Parma, Italy. 2 Dipartimento di Scienze Animali, Sezione di Zootecnica Agraria, Università di Milano, Via Caloria, 220133 Milano, Italy. 3 Department...

Ngày tải lên: 12/08/2014, 01:22

... Paper ISOLATION OF CHLAMYDIA PNEUMONIAE FROM SERUM SAMPLES OF THE PATIENTS WITH ACUTE CORONARY SYNDROME Ivan M Petyaev 1 , Nayilia A Zigangirova 2 , Alexey M Petyaev 3 , Ulia P Pashko 2 , Lubov ... patients with an acute coronary syndrome may contribute towards enhanced pro-inflammatory status in cardiovascular patients and development of secondary complica- tions of ather...

Ngày tải lên: 26/10/2012, 08:57

... 2005, 310:644-648. 4. Soda M, Choi YL, Enomoto M, Takada S, Yamashita Y, Ishikawa S, Fujiwara S, Watanabe H, Kurashina K, Hatanaka H, Bando M, Ohno S, Ishikawa Y, Aburatani H, Niki T, Sohara Y, Sugiyama Y, Mano H: ... SLX_PE_Adapter1_us 5 A* CACTCTTTCCCTACACGACGCTCTTCCGATCT; PCR library, SLX_P E_PCR_Primer1f 5’ A* ATGA- TACGGCGA CCACCGAGATCTACACTCTTTCCCTA- CACGACGCTCTTCCGATC*T, SLX_PE_P...

Ngày tải lên: 09/08/2014, 22:23

... Yogesh Chander, Muthanan A Ramakrishnan, Patrick T Redig, Srinand Sreevatsan Abstract From April 2007 to March 2008, cloacal swabs were obtained from 246 casualty raptors recovered by various wild- life ... feeding habits, raptors may also play an impor- tant role in the spread of AIV. Some species of raptors often feed on ducks and geese and if these birds are car- rying AIV, raptors...

Ngày tải lên: 12/08/2014, 04:20

... Hirakata Y, Tanaka H, Yoshida R, Tomono K, Koga H, Wada A, Hirayama T, Kamihira S: Evaluation of susceptibility of gram-positive and -negative bacteria to human defensins by using radial diffusion assay. ... Watanabe M, Yamashita T, Ogawa Y, Koh H, Hasegawa N, Nakamura H, Asano K, Yamaguchi K, Kotani M, Kotani T, Morisaki H, Takeda J, Kobayashi K, Ogawa S: New bronchoscopic microsa...

Ngày tải lên: 12/08/2014, 18:20

... van der, Awasana AA, Sarge-Njie R, Sande M van der, Jaye A, Sabally S, et al.: Sixteen years of HIV surveillance in a West African research clinic reveals divergent epidemic trends of HIV-1 and ... that the patient was HIV-2 infected and provided valuable demo- graphic data. RG, AG, CA, and PAM amplified gag and per- formed the phylogenic analysis. All authors read and approved the f...

Ngày tải lên: 13/08/2014, 05:21

... evolutionary histories of genes can be attributed to three major factors, including paralogy, hybridization, and lineage sorting [40]. We have largely ruled out the potential effect of paralogy by carefully ... Nagata T, Kawagashira N, Doi K, Kishimoto N, Yazaki J, Ishikawa M, Yamada H, Ooka H, Hotta I, Kojima K, Namiki T, Ohneda E, Yahagi W, Suzuki K, Li CJ, Ohtsuki K, Shishiki T, Ot...

Ngày tải lên: 14/08/2014, 08:20

... Membrane Protein Group, 2 Anatomy and 3 Cell Biology, Faculty of Medicine and Dentistry, University of Alberta, Edmonton, Alberta, Canada The Na + /H + exchanger is a ubiquitous membrane protein of ... (Temecula, CA, USA) and calpain I inhibitor was from Calbiochem (San Diego, CA, USA). Anti Na + /K + ATPase Ig (6F) was from the Develop- mental Studies Hybridoma Bank (Iowa City, Iow...

Ngày tải lên: 08/03/2014, 16:20

... has expanded beyond schizophrenia to include a variety of mental disorders [2,3]. Atypical antipsychotics are being increasingly used to control acute manic episodes, and data are emerging to support ... double-blind, placebo-con- trolled comparison of efficacy and safety. American Journal of Psy- chiatry 2002, 159:1146-1154. 7. Yatham LN: Mood stabilization and the role of an...

Ngày tải lên: 08/08/2014, 20:23