Báo cáo y học: "Two discrete events, human T-cell leukemia virus type I Tax oncoprotein expression and a separate stress stimulus, are required for induction of apoptosis in T-cells" pptx
Báo cáo y học: "Two-year Outcome of Turkish Patients Treated with Zotarolimus Versus Paclitaxel Eluting Stents in an Unselected Population with Coronary Artery Disease in the Real World: A Prospective Non-randomized Registry in Southern Turk
... trials indicate that the ZES is safe and reduces the rates of clinical and angiographic restenosis in patients with symptomatic coronary ar-tery disease (CAD; 4). Also the safety and efficacy ... Association; CABG: coronary artery binding graft; CK: creatine kinase; MACE: major ad-verse cardiac events; MI: myocardial infarction; PES: paclitaxel- eluting stent; ZES: zotarolimus- eluting ... days and very late, >1 year). Myocardial infarction was defined as a creatine kinase (CK) elevation >2 times above the upper limit of normal levels with any associated elevation in the...
- 6
- 550
- 0
Báo cáo y học: " Two-stage procedure in the treatment of late chronic hip infections spacer"
... types of spacers used in the treatment of chronically in- fected THA and conclude that hip spacers are effective in the treatment of hip joint infec-tions. Key words: Total hip arthroplasty; ... according to the sensitivity of the infecting organism but conventionally have to fulfil the criteria estab-lished by Murray [24] including: antibiotic safety, thermostability, hypoallergenicity, water ... vanco-mycin [26]. The combination of vancomycin and one of the aminoglycosides provides a broad spectrum of coverage for organisms commonly encountered with deep periprosthetic infections...
- 5
- 549
- 0
Báo cáo Y học: Two different E2F6 proteins generated by alternative splicing and internal translation initiation ppt
... efcient translation initiation by ribosomal scanningfor both E2F6b and E2F6, and suggest that their translation may be initiated internally. Two different E2F6 proteins accumulate in cellsIf translation ... inhibited cells. E2F6 and E2F6b expression was again analyzed by RT-PCR withFig. 5. Expression of E2F6 and E2F6b. (A)ExpressionofE2F 6and E2F6b in primary mouse tissues was analyzed by RT-PCR withprimers ... the E2F6b mRNA. E2F6 and E2F6b are ubiquitously expressedIt has previously been reported that E2F6 is ubiquitouslyexpressed in mouse tissues [10]. To analyze the relativeexpression of E2F6 and...
- 7
- 323
- 0
Báo cáo Y học: Two GPX-like proteins from Lycopersicon esculentum and Helianthus annuus are antioxidant enzymes with phospholipid hydroperoxide glutathione peroxidase and thioredoxin peroxidase activities pptx
... Two GPX-like proteins from Lycopersicon esculentum and Helianthus annuus are antioxidant enzymes with phospholipid hydroperoxide glutathione peroxidase and thioredoxin peroxidase activities Ste´phane ... study investigated the enzymatic function of two putative plant GPXs, GPXle1 from Lycopersicon esculentum and GPXha2 from Helianthus annuus, which show sequenceidentities with the mammalian phospholipid ... phospholipid hydroperoxide glutathione peroxidase (PHGPX). Both purified recombin-ant proteins expressed in Escherichia coli show PHGPXactivity by reducing alkyl, fatty acid and phospholipid hydroperoxides...
- 7
- 362
- 0
Báo cáo Y học: Two independent, light-sensing two-component systems in a filamentous cyanobacterium pot
... cphA:forward,GCGATACCATGGTATCCGAATTCCAAG and reverse, ACCCGGGTCGACTCAGTGATGGTGGTGATGGTGTCCTCGACCAAAAAGATC; rcpA:forward,GCGATAGAATTCATGAGCGTAGAAACGGAAGAC and reverse, CGAAGCTTGTCGACTCAGTGATGGTGGTGATGGTGCTCCGACGGCAATGTCG; ... CGAAGCTTGTCGACTCAGTGATGGTGGTGATGGTGCTCCGACGGCAATGTCG; cphB:forward,GCGATAGAATTCATG ACGAATTGCGATCGCGA and reverse, ACCCGGGTCGACTCAGTGATGGTGGTGATGGTGTTTGACCTCCTGCAATGT; cphBlong:forward,GCGATAGAATTCATGTTGCAGTTAATTTATAACAATT; ... cphBlong:forward,GCGATAGAATTCATGTTGCAGTTAATTTATAACAATT; the reverseprimer was identical to that used for cphB; rcpB:forward,GAGGCTGAATTCATGGTAGGAAACGCTACTCAAC;reverse, CGAAGCTTGTCGACTCAGTGATGGTGGTGATGGTGACCCATCTCAGGAAGTACAAC.Ó...
- 10
- 499
- 0
Báo cáo Y học: Two 1 : 1 binding modes for distamycin in the minor groove of d(GGCCAATTGG) docx
... prepared usingBOBSCRIPT[34].Ó FEBS 2002 Two 1 : 1 binding modes for distamycin (Eur. J. Biochem. 269) 2875 Two 1 : 1 binding modes for distamycin in the minor groove of d(GGCCAATTGG) Koen Uytterhoeven 1 , ... current crystal structures describe the interaction of distamycin in the minor groove of the central CAATTGsequence in a 1 : 1 binding mode. The present tight crystalpacking due to the triplet formation ... side-by-side binding of two distamycin molecules in the minor groove of d(CGCAATTGCG) [6]. More structuralinformation about this 2 : 1 binding mode was firstprovided by the crystal structure of...
- 10
- 411
- 0
Báo cáo Y học: Kinetic studies of human tyrosyl-DNA phosphodiesterase, an enzyme in the topoisomerase I DNA repair pathway pot
... understand the enzymatic mechanism of this novel enzyme, and tofacilitate inhibitor screening of human TDP, we haveexpressed and purified recombinant human TDP variantscarrying deletions of 1–39 ... human TDPvariants was approximated to be 5 mgặL)1 of E. coli culture(Fig. 2).TDP is involved in the Topo I DNA repair pathway, andinhibitors of TDP may have therapeutic utility in treatingcancers ... The requirement of cofactor for TDP enzymaticactivity was examined by determining the specific activity of TDP by following the cleavage of 1 mM of substrate by0.125 lM of enzyme in reaction...
- 8
- 503
- 0
Báo cáo y học: "The potential of human regulatory T cells generated ex vivo as a treatment for lupus and other chronic inflammatory diseases" pot
... syndrome and alter the course of established disease. These data suggest thatautologous T cells primed and expanded with TGF-β have the potential to be used as a therapy for patients with systemic ... systemic lupus erythematosus and other chronic inflammatory diseases. This noveladoptive immunotherapy also has the potential to prevent the rejection of allogeneic transplants.Keywords: autoimmunity, ... generate sup-pressor T cells ex vivo in large numbers, and raises thepossibility that the transfer of these cells back to the donorCommentaryThe potential of human regulatory T cells generated...
- 6
- 408
- 0
Báo cáo y học: "Polarized subsets of human T-helper cells induce distinct patterns of chemokine production by normal and systemic sclerosis dermal fibroblasts" doc
... by Th2 cells were affected strongly by both U-0126 and PSI and weakly by the JNK inhibitor (Fig-ure 6a,c). Finally, IP-10 mRNA levels induced by Th1 cells were decreased by U-0126 and PSI, and ... preferen-tially by Th1 cells and IL-8 mainly by Th2 cells, whereas MCP-1 is induced equally by both subsets. This illustrates thecapacity of fibroblasts to activate flexible patterns of chemok-ine production ... effects of the same quality and magni-tude as those induced by polarized T cells. For instance, IL-8was not induced by any of the Th1 and Th2 cytokines, but wasstrongly induced by Th2 and to...
- 12
- 388
- 0
Báo cáo y học: "Dominance of highly divergent feline leukemia virus A progeny variants in a cat with recurrent viremia and fatal lymphoma" pdf
... feline leukemia virus A progeny variants in a cat with recurrent viremia and fatal lymphoma. Retrovirology 2010 7:14.Submit your next manuscript to BioMed Central and take full advantage of: ã Convenient ... FeLV -A/ Glasgow-1 and env variant loads in all tissues. D) Viral(cDNA) env variant loads in tissues with and without apparent lymphoma. E) Time course of provirus loads of FeLV -A/ Glasgow-1 and env variants in ... viral loads of the FeLVchallenge strain and the evolved progeny variants usingsensitive, discriminating real-time PCR assays. The virus variants had largely replaced the inoculated proto-type...
- 17
- 314
- 0
Báo cáo y học: " Journey to the heart of macrophages: the delicate relationship between HIV-1 and a multifaceted cell type" ppt
... this article as: Cimarelli: Journey to the heart of macrophages: the delicate relationship between HIV-1 and a multifaceted cell type.Retrovirology 2010 7:28.Submit your next manuscript to BioMed ... collectively named HIV encephalitis(HIVE) is described by the accompan ying review of Gras and Kaul [11]. Finally, the interplay between macrophage polarization and the effect that differentviral proteins ... differentiation into macrophages and interactionwith T cells. Virology 2006, 344:267-276.2. Mantovani A, Sica A, Sozzani S, Allavena P, Vecchi A, Locati M: The chemokine system in diverse forms of macrophage...
- 2
- 287
- 0
Báo cáo y học: "Two distinct variants of simian foamy virus in naturally infected mandrills (Mandrillus sphinx) and cross-species transmission to human" pptx
... www.biomedcentral.com/submitMouinga-Ondémé et al. Retrovirology 2010, 7:105http://www.retrovirology.com/content/7/1/105Page 12 of 12 Two distinct variants of simian foamy virus in naturally infected mandrills (Mandrillus ... a monkey species living in central Africa, is naturally infected with SFV. We evaluated the naturalhistory of the virus in a free-ranging colony of mandrills and investigated possible transmission ... two distinct variants of simian foamy virus To determine the origin and distribution of the differentclades in the mandrill colony, a 267-bp portion of thecytochrome b sequence was amplified and...
- 13
- 357
- 0
Báo cáo y học: " No association of xenotropic murine leukemia virus-related virus with prostate cancer or chronic fatigue syndrome in Japa" doc
... Open Access No association of xenotropic murine leukemia virus- related virus with prostate cancer or chronic fatigue syndrome in JapanRika A Furuta1*, Takayuki Miyazawa2, Takeki Sugiyama3, ... W: Absence of evidence of Xenotropic Murine Leukemia Virus- related virus infection in persons with Chronic Fatigue Syndrome and healthy controls in theUnited States. Retrovirology 2010, 7:57.12. ... Li J, Li Y: Failure to detect Xenotropic murine leukaemia virus- related virus in Chinese patients with chronic fatigue syndrome. Virol J2010, 7:224.13. Enserink M: Chronic fatigue syndrome. ...
- 12
- 310
- 0
Báo cáo y học: " Functional analysis of human T lymphotropic virus type 2 Tax proteins" pptx
... appeared to only reduce theactivity of Tax 2B. However the introduction of anarginine instead of a cysteine at this position (Y1 44R) into Tax 2B abolished its activity indicating that this positionis ... prevalence of mutations in Tax 2A pro-teins which inactivate both pathways may influence thepathogenic properties of certain HTLV-2A viruses.Table 4: Transactivation phenotypes of Tax 2B mutantsMutation ... to transactivate NFkB but retained thecapacity to transactivate the HTLV-1 LTR [13,19]. In thepresent study insertion of the mutation at position 24 8into both Tax 1 and 2B also abolished their...
- 10
- 276
- 0
Báo cáo y học: "Two discrete events, human T-cell leukemia virus type I Tax oncoprotein expression and a separate stress stimulus, are required for induction of apoptosis in T-cells" pptx
... expression and a separate stress stimulus, are required for induction of apoptosis in T-cellsTakefumi Kasai and Kuan-Teh Jeang*Address: Laboratory of Molecular Microbiology, NIAID, National Institutes ... c-Jun N-terminal kinase /stress- activated proteinkinase pathway. A role for mixed lineage kinase 3/protein-tyrosine kinase 1, a novel member of the mixed lineagekinase family. J Biol Chem 1996, ... Wealso noted with interest that similar to our findings (Fig-ure 6A, 6C), Zn activation of a death pathway in a human Burkitt lymphoma B cell line was associated with activa-tion of caspase-9...
- 12
- 240
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ