Báo cáo y học: " A murine leukemia virus with Cre-LoxP excisible coding sequences allowing superinfection, transgene delivery, and generation of host genomic deletions" pptx

... bp|-gacgtctcagaggcatcgggggcccg ctgggtggcccaatcagtaagtccgagtc SfuI SpeI Akv-2XY Env-aagttcgaa-LoxP-actagtgcggccgtttagtgaataaaagattttattcagtttacagaaagagggggg-3’LTR Akv -Y Env-aag attttattcagtttacagaaagagggggg-3’LTR Retrovirology ... 1 AYGC. 2A3 Akv -Y A 1.0 1 AYGC.2C3 Akv -Y B 0.6 1 AYGC.3B2 Akv -Y C 2.5 2–3 A2 XYGC. 2A2 Akv-2XY D 49.8 29 A2 XYGC.2B1 Akv-2XY E 45.7 27 A2 XYGC.2C1 Akv-2...

Ngày tải lên: 13/08/2014, 13:20

... regions. Indeed, the amount of A- MLV particles associated with large rafts within 30 minutes of virus exposure suggests that rafts are involved in early events of A- MLV binding and that A- MLV virions ... cells outside of caveolae and subsequently associate with cave- olae in the entry process. Furthermore, in agreement with the slow infection kinetic of A- MLV the...

Ngày tải lên: 20/06/2014, 01:20

... cysts of the jaws. They are frequently noted as an incidental finding on radiographs because a majority of these cysts are asymptomatic and are most commonly associated with impacted mandibular ... before submission. Author details 1 Department of Oral Biology, Section of Oral and Maxillofacial Pathology and Radiology, University of Nebraska Medical Center College of Den...

Ngày tải lên: 10/08/2014, 23:21

... 5 Division of Laboratory and Pathology, National Cancer Institute, National Institutes of Health, Bethesda, Maryland, USA and 6 Molecular Imaging Program, National Cancer Institute, National Institutes ... Materials from several excised polyps were reviewed at the NIH Laboratory of Pathology, and revealed a mixed polyposis of 5 adenomatous polyps, 2 hamartomatous polyps (F...

Ngày tải lên: 11/08/2014, 10:22

... Tajiri T, Mamada Y, Taniai N, Mineta S, Hirakata A, Futami R, Arima Y, Inoue M, Hatta S, Kishimoto A: Infected hepatic cyst. Hepatogastroenterology 2003, 50:507-509. 3. Kitajima Y, Okayama Y, ... Hirai M, Hayashi K, Imai H, Okamoto T, Aoki S, Akita S, Gotoh K, Ohara H, Nomura T, Joh T, Yokoyama Y, Itoh M: Intracystic hemorrhage of a simple liver cyst mimicking a biliary cystadeno...

Ngày tải lên: 11/08/2014, 21:22

... fumarate and topiramate for approximately 3 years. On examination, she appeared chronically ill and anx- ious. She had a temperature of 99.8°F, was tachycardic (137/min), tachypneic (26/min) with ... disease, irritable bowel syndrome for 10 years, migraine head- aches and bipolar disorder for 2–3 years, and tonsillec- tomy as a child. She had a normal mammogram 4 years prior...

Ngày tải lên: 11/08/2014, 23:21

... the ShanDong Academy of Agricultural Sciences Great Innovation Fund (2007YCX017-04) and the ShanDong Academy of Agricultural Sciences Youth Fund (2006YQN033). The authors thank Ms. Sara and Dr ... of Swine Diseases, Shandong Provincial Key Laboratory of Animal Disease Control & Breeding, Institute of Animal Science and Veterinary Medicine Shandong Academy of Agricultural...

Ngày tải lên: 12/08/2014, 04:20

... Iida A, Sudo A, Miyamoto Y, Fukuda A, Mabuchi A, Kotani A, Kawakami A, Yamamoto S, Uchida A, Nakamura K, Notoya K, Nakamura Y, Ikegawa S: An aspartic acid repeat polymorphism in asporin inhibits ... expression of cartilage matrix genes such as collagen type II and aggrecan, and inhibits accumulation of proteoglycan [39]. Kizawa and colleagues found an asporin polymorph...

Ngày tải lên: 12/08/2014, 11:22

... Ct Gapdh ). Statistical analysis Data are represented as mean ± standard error of the mean, and significant differences were calculated using Student t test, one-way analysis of variance, or Mann- Whitney ... contributions OJA helped to acquire data and contributed to the study design, statistical and data analysis, interpretation of data, and drafting of the manuscript. SV, B...

Ngày tải lên: 12/08/2014, 12:20

... labeled, and hybridized to Affymetrix Drosophila 2.0 arrays, using a strictly randomized experimental design. The raw array data were normalized using a median standardization. The measure of ... genetic analyses The analysis of variance (ANOVA) model Y = μ + L + ε was used to partition variation in male aggressive behavior and transcript abundance between lines (L, random)...

Ngày tải lên: 14/08/2014, 21:20