Báo cáo y học: "Establishment of a novel CCR5 and CXCR4 expressing line which is highly sensitive to HIV and suitable for high-throughput evaluation of CCR5 and CXCR4 antagonists" pdf

... here is most valuable as a tool for high-throughput evaluation of new CCR5 and CXCR4 inhibitors and in vitro evaluation of their therapeutic potential in combination anti -HIV therapy. Materials and ... T-cell- line- adapted HIV- 1. Nature 1996, 382:833-835. 18. Baba M, Nishimura O, Kanzaki N, Okamoto M, Sawada H, Iizawa Y, Shiraishi M, Aramaki Y, Okonogi K, Og...

Ngày tải lên: 13/08/2014, 13:20

... Sequence analysis of the Drosophila genome has already demonstrated that it contains 32 ugt genes [44]. Biochemical evidence and comparisons with mammalian systems point to a range of important functions for ... UDP- glycosyltransferase. The UDP-glycosyltransferases ( UGTs) are a superfamily of enzymes that p lay a central role in the detoxication and elimination of a...

Ngày tải lên: 22/02/2014, 04:20

... discussion 1066. 4. Chang H, Israel H: Analysis of inflammatory mediators in tem- poromandibular joint synovial fluid lavage samples of symp- tomatic patients and asymptomatic controls. J Oral ... cells into the synovial tissue and joint space is another key characteristic of synovitis, which combined with release of these mediators and degradative enzymes, eventually leads...

Ngày tải lên: 11/08/2014, 08:21

... T, Nakamura Y, Nakamura F, Shirakura T, Adachi J, Goto N, Okamoto K, Hasegawa M: Protein phylogeny gives a robust estimation for early divergences of eukaryotes: phylogenetic place of a mitochondria-lacking ... Science, Waltham, MA, USA) and exposure to K odak BioMax XAR film (Eastman Kodak, Rochester, NY, USA). Statistical analysis Comparisons between two means were analyzed b...

Ngày tải lên: 12/08/2014, 01:21

... CTTTGGTCGACTTATTCCCCCGGATAATAGAT 1411-1575 165 F2-3 TGCAG GGATCCATGAATGACGACCAGTTAGAT GTCGACTTAAGCTAATGGTCCAGTAGA 1531-1731 201 F4 TGCAG GGATCCATGAATGACGACCAGTTAGAT CTTTGGTCGACTTATTCCCCCGGATAATAGAT ... TGCAG GGATCCATGATCTATTATCCGGGGGAA CTTTGGTCGACTTATTCCCCCGGATAATAGAT 1558-1575 18 F13 GATCCATGATCTATTATCCGGGGTAAG TCGACTTACCCCGGATAATAGATCATG 1558-1572 15 F14 GATCCATGTATTATCCGGGGGAATAAG TCGACTTA...

Ngày tải lên: 12/08/2014, 01:21

... and another PCR analysis was performed using the same primers as in the initial analysis. DNA of organs and tissue supernatants was extracted using the QiAamp tissue kit according to the manufacturer's ... DNA polymerase and glycoprotein B genes revealed a 3.4 kb sequence that was similar to sequences of rodent cytomegaloviruses. Pairwise sequence comparisons and phylog...

Ngày tải lên: 12/08/2014, 04:21

... Mimori T, Matsuda F, Iwamoto T, Momohara S, Yamanaka H, Yamada R, Kubo M, Nakamura Y, Yamamoto K: A regulatory variant in CCR6 is associated with rheumatoid arthritis susceptibility. Nat Genet 2010, ... at early and late stages of disease. Serum was isolated from AR and NAR littermates, and the levels of six cytokines were measured by cytometric bead array. Only (A) IL-6 and...

Ngày tải lên: 12/08/2014, 17:22

... strain as a new murine model of infl ammatory, possibly auto- immune, arthritis.  e IIJ strain is similar both histologically and serologically to RA and other murine models of auto immune arthritis. ... as: Cuzzocrea S: Characterization of a novel and spontaneous mouse model of in ammatory arthritis. Arthritis Research & Therapy 2011, 13:126. Cuzzocrea Arthr...

Ngày tải lên: 12/08/2014, 17:22

... Tax2 Toshiyuki Shoji †1,2 , Masaya Higuchi †1 , Rie Kondo 1 , Masahiko Takahashi 1 , Masayasu Oie 1 , Yuetsu Tanaka 3 , Yutaka Aoyagi 2 and Masahiro Fujii* 1 Address: 1 Division of Virology, Niigata ... Masahiko Takahashi - masahiko@med.niigata-u.ac.jp; Masayasu Oie - moie@med.niigata-u.ac.jp; Yuetsu Tanaka - yuetsu@s4.dion.ne.jp; Yutaka Aoyagi - aoy@med.niigata-u.ac.jp; Masahiro Fuj...

Ngày tải lên: 12/08/2014, 23:22

... susceptibility and replicative capacity. Results: A large database (Quest Diagnostics database) was analysed to determine the associations of the E40F and K43E changes with known resistance mutations. ... 43E-RT (5' ACA GAG CTG GAA GAG GAA GGG AAA A- 3', nucleotides 2664–2688) and 43E- RTA (5' ACA TTT CTG GAA GAG GAA GGG AA-3', nucle- otides 2664–2686) were us...

Ngày tải lên: 13/08/2014, 06:20