Báo cáo y học: "Expiratory automatic endotracheal tube compensation reduces dynamic hyperinflation in a physical lung model" doc

... exemplifying effects of expiratory automatic endotracheal tube compensation on lung emptying Original tracings exemplifying effects of expiratory automatic endotracheal tube compensation on lung ... expiratory and inspir- atory volumes, an air leak may cause overcompensation and thus can lead to an inadequate fall in tracheal and possibly even in alveolar pressure. Thu...

Ngày tải lên: 13/08/2014, 11:23

... and Topoisomerase-alpha proteins by CAV1 and Topoisomerase-alpha antibody. Primary anti- body staining was followed by incubation with anti- mouse or anti-rabbit secondary IgG polymer conjugated with ... resveratrol. J Nat Prod 2005, 68:36-42. 14. Tyagi A, Singh RP, Agarwal C, Siriwardana S, Sclafani RA, Agarwal R: Resveratrol causes Cdc2-tyr15 phosphorylation via ATM/ ATR-Chk1/2-Cdc25C path...

Ngày tải lên: 18/06/2014, 15:20

... family with the same abnormal hemoglobin described previously from Turkey. 2. A CASE REPORT AND RESULTS The propositus was a healthy 34-year old male native of Isparta, a city situated in ... increase in red blood cell count, as compared against a normal individual, was observed. Key words: Hb J-Meerut [α 120 (H3) Ala->Glu (α1)], DNA analysis, Turkish male, slightly incr...

Ngày tải lên: 02/11/2012, 10:09

... of calcium-containing crystals in articular cartilage observed in these families is a common finding that is fre- quently associated with advanced OA. In contrast to general- ized arterial calcification ... Chaisson CE, Hannan MT, Zhang Y, McAlindon TE, LaValley M, Levy D, Myers RH: Evidence for a Mendelian gene in a segregation analysis of generalized radi- ographic osteoarth...

Ngày tải lên: 09/08/2014, 06:23

... immu- nohistochemistry, as well as the respective data analyses and participated in writing the manuscript. AB analyzed the micro- array data and participated in writing the manuscript. DK per- formed the microarray ... was comparatively investigated in early-passage rheumatoid arthritis (RA) and osteoarthritis (OA) synovial fibroblasts (SFBs; n = 6 each) using oligonucleotide microarra...

Ngày tải lên: 09/08/2014, 10:20

... 3' 18S PDAR PDAR (VIC-TAMRA) PDAR Caveolin-1 ACT TGC AAC CGT CTG TTA TGC T FAM – ACA TGG CCC CTC CCC – MGB GCA AAG GGA TGC TTG GAT TAG GT p16 INK 4a GGC TCT ACA CAA GCT TCC TTT CC FAM – ACC CTG ... degeneration in some individuals. There is increasing evidence that many features of IVD degen- eration, including altered matrix synthesis and enhanced matrix degradation, originate at a...

Ngày tải lên: 09/08/2014, 10:23

... inhibit structural damage in ankylosing spondylitis. Introduction Ankylosing spondylitis (AS) is a frequent chronic inflammatory rheumatic disease that already affects the axial skeleton at a young ... this part of the spine was not avail- able for analysis. As recently proposed, we defined 'definite radiographic damage' as the appearance of at least one syn- desmophyte in e...

Ngày tải lên: 09/08/2014, 13:21

... 4:e4. 41. Yamaguchi-Kabata Y, Nakazono K, Takahashi A, Saito S, Hosono N, Kubo M, Nakamura Y, Kamatani N: Japanese population structure, based on SNP genotypes from 7003 individuals compared to ... a better means for adapting hzA- nalyzer parameters to local, rather than global, error rates (that is, heterozygosity thresholds, SNP density). In examining and quantifying contiguous homoz...

Ngày tải lên: 09/08/2014, 22:23

... pairs (CCR5-F1: 5'ATGGAGGGCAACTAAATACATT3'; CCR5-R1: 5'AGATGACTATCTTTAATGTCTG3'; CCR5-F2: 5'CTCTCATTTTCCATACAGTCAGTATCA3'; CCR5-R2: 5'AAGCCATGTGCACAACTCTGACTG3') ... was obtained by using primers CD45-F: 5'-GATTGACTACAG- CAAAGATGCCC-3' and CD45-R: 5'-CCTCTGTGGTAT- TAAAAGCACTAGCA-3'; subsequent HpaII digestion of PCR products evidence...

Ngày tải lên: 10/08/2014, 05:20

... CD4+ Strata at HAART Initiation for All Par ticipants, U.S. Military HIV Natural History Study. Table 2 Average Change in CD4+ Count by Time Since HAART Initiation: All Participants and Viral Suppressors ... confounding by adjusting for many HIV- related factors, as well as time-dependent covariates including VL and HAART use. Analyzing our data in different ways, including through severa...

Ngày tải lên: 10/08/2014, 05:21