Báo cáo y học: "Expiratory automatic endotracheal tube compensation reduces dynamic hyperinflation in a physical lung model" doc

Báo cáo y học: "Expiratory automatic endotracheal tube compensation reduces dynamic hyperinflation in a physical lung model" doc

Báo cáo y học: "Expiratory automatic endotracheal tube compensation reduces dynamic hyperinflation in a physical lung model" doc

... exemplifying effects of expiratory automatic endotracheal tube compensation on lung emptying Original tracings exemplifying effects of expiratory automatic endotracheal tube compensation on lung ... expiratory and inspir- atory volumes, an air leak may cause overcompensation and thus can lead to an inadequate fall in tracheal and possibly even in alveolar pressure. Thu...

Ngày tải lên: 13/08/2014, 11:23

9 203 0
báo cáo hóa học:" Caveolin-1 enhances resveratrol-mediated cytotoxicity and transport in a hepatocellular carcinoma model" docx

báo cáo hóa học:" Caveolin-1 enhances resveratrol-mediated cytotoxicity and transport in a hepatocellular carcinoma model" docx

... and Topoisomerase-alpha proteins by CAV1 and Topoisomerase-alpha antibody. Primary anti- body staining was followed by incubation with anti- mouse or anti-rabbit secondary IgG polymer conjugated with ... resveratrol. J Nat Prod 2005, 68:36-42. 14. Tyagi A, Singh RP, Agarwal C, Siriwardana S, Sclafani RA, Agarwal R: Resveratrol causes Cdc2-tyr15 phosphorylation via ATM/ ATR-Chk1/2-Cdc25C path...

Ngày tải lên: 18/06/2014, 15:20

13 714 0
Báo cáo y học: "Hb J- Meerut [α 120 (H3) Ala -Glu (α1)] In A Turkish Male"

Báo cáo y học: "Hb J- Meerut [α 120 (H3) Ala -Glu (α1)] In A Turkish Male"

... family with the same abnormal hemoglobin described previously from Turkey. 2. A CASE REPORT AND RESULTS The propositus was a healthy 34-year old male native of Isparta, a city situated in ... increase in red blood cell count, as compared against a normal individual, was observed. Key words: Hb J-Meerut [α 120 (H3) Ala->Glu (α1)], DNA analysis, Turkish male, slightly incr...

Ngày tải lên: 02/11/2012, 10:09

2 503 0
Báo cáo y học: "Association of ENPP1 gene polymorphisms with hand osteoarthritis in a Chuvasha population" doc

Báo cáo y học: "Association of ENPP1 gene polymorphisms with hand osteoarthritis in a Chuvasha population" doc

... of calcium-containing crystals in articular cartilage observed in these families is a common finding that is fre- quently associated with advanced OA. In contrast to general- ized arterial calcification ... Chaisson CE, Hannan MT, Zhang Y, McAlindon TE, LaValley M, Levy D, Myers RH: Evidence for a Mendelian gene in a segregation analysis of generalized radi- ographic osteoarth...

Ngày tải lên: 09/08/2014, 06:23

9 411 0
Báo cáo y học: "Constitutive upregulation of the transforming growth factor-β pathway in rheumatoid arthritis synovial fibroblasts" doc

Báo cáo y học: "Constitutive upregulation of the transforming growth factor-β pathway in rheumatoid arthritis synovial fibroblasts" doc

... immu- nohistochemistry, as well as the respective data analyses and participated in writing the manuscript. AB analyzed the micro- array data and participated in writing the manuscript. DK per- formed the microarray ... was comparatively investigated in early-passage rheumatoid arthritis (RA) and osteoarthritis (OA) synovial fibroblasts (SFBs; n = 6 each) using oligonucleotide microarra...

Ngày tải lên: 09/08/2014, 10:20

11 400 0
Báo cáo y học: "Caveolin-1 expression and stress-induced premature senescence in human intervertebral disc degeneration" docx

Báo cáo y học: "Caveolin-1 expression and stress-induced premature senescence in human intervertebral disc degeneration" docx

... 3' 18S PDAR PDAR (VIC-TAMRA) PDAR Caveolin-1 ACT TGC AAC CGT CTG TTA TGC T FAM – ACA TGG CCC CTC CCC – MGB GCA AAG GGA TGC TTG GAT TAG GT p16 INK 4a GGC TCT ACA CAA GCT TCC TTT CC FAM – ACC CTG ... degeneration in some individuals. There is increasing evidence that many features of IVD degen- eration, including altered matrix synthesis and enhanced matrix degradation, originate at a...

Ngày tải lên: 09/08/2014, 10:23

9 317 0
Báo cáo y học: "The relationship between inflammation and new bone formation in patients with ankylosing spondylitis" docx

Báo cáo y học: "The relationship between inflammation and new bone formation in patients with ankylosing spondylitis" docx

... inhibit structural damage in ankylosing spondylitis. Introduction Ankylosing spondylitis (AS) is a frequent chronic inflammatory rheumatic disease that already affects the axial skeleton at a young ... this part of the spine was not avail- able for analysis. As recently proposed, we defined 'definite radiographic damage' as the appearance of at least one syn- desmophyte in e...

Ngày tải lên: 09/08/2014, 13:21

7 440 0
Báo cáo y học: " hzAnalyzer: detection, quantification, and visualization of contiguous homozygosity in high-density genotyping datasets" doc

Báo cáo y học: " hzAnalyzer: detection, quantification, and visualization of contiguous homozygosity in high-density genotyping datasets" doc

... 4:e4. 41. Yamaguchi-Kabata Y, Nakazono K, Takahashi A, Saito S, Hosono N, Kubo M, Nakamura Y, Kamatani N: Japanese population structure, based on SNP genotypes from 7003 individuals compared to ... a better means for adapting hzA- nalyzer parameters to local, rather than global, error rates (that is, heterozygosity thresholds, SNP density). In examining and quantifying contiguous homoz...

Ngày tải lên: 09/08/2014, 22:23

27 449 0
Báo cáo y học: " Partial protective effect of CCR5-Delta 32 heterozygosity in a cohort of heterosexual Italian HIV-1 exposed uninfected individuals" pdf

Báo cáo y học: " Partial protective effect of CCR5-Delta 32 heterozygosity in a cohort of heterosexual Italian HIV-1 exposed uninfected individuals" pdf

... pairs (CCR5-F1: 5'ATGGAGGGCAACTAAATACATT3'; CCR5-R1: 5'AGATGACTATCTTTAATGTCTG3'; CCR5-F2: 5'CTCTCATTTTCCATACAGTCAGTATCA3'; CCR5-R2: 5'AAGCCATGTGCACAACTCTGACTG3') ... was obtained by using primers CD45-F: 5'-GATTGACTACAG- CAAAGATGCCC-3' and CD45-R: 5'-CCTCTGTGGTAT- TAAAAGCACTAGCA-3'; subsequent HpaII digestion of PCR products evidence...

Ngày tải lên: 10/08/2014, 05:20

4 384 0
Báo cáo y học: " Long-term CD4+ lymphocyte response following HAART initiation in a U.S. Military prospective cohort" potx

Báo cáo y học: " Long-term CD4+ lymphocyte response following HAART initiation in a U.S. Military prospective cohort" potx

... CD4+ Strata at HAART Initiation for All Par ticipants, U.S. Military HIV Natural History Study. Table 2 Average Change in CD4+ Count by Time Since HAART Initiation: All Participants and Viral Suppressors ... confounding by adjusting for many HIV- related factors, as well as time-dependent covariates including VL and HAART use. Analyzing our data in different ways, including through severa...

Ngày tải lên: 10/08/2014, 05:21

11 481 0
w