... activation [2]. Thrombin may also affect the production of inflammatory cytokines by binding to protease -activated receptors (PARs) in mononuclear cells [3]. Secondly, rhAPC may inhibit the action ... 4 days, respectively (Fig. 3). Figure 2 Levels of protein C and protein C inhibitorLevels of protein C and protein C inhibitor. Plasma levels of (a) protein C and (b) pr...
Ngày tải lên: 12/08/2014, 22:22
... proteins were extracted respectively according to instructions of Nuclear and Cytoplasmic Protein Extraction Kit. Protein concentrations were determined by BCA protein assay kit. Samples were ... Biological Technology, Ltd. (Wuhan, China). Nuclear and cytoplasmic protein extraction kit was purchased from Beyotime Institute of Biotechnology (Beijing, China). BCA protein assay kit was...
Ngày tải lên: 12/08/2014, 11:21
Báo cáo y học: "Early biomarkers and potential mediators of ventilation-induced lung injury in very preterm lambs" ppt
... AGGGTCACTGTGGAAGGTC GCAGCTGAAGTCAAAGGAA CTGF DQ239672 407–469 TATAGCTCCAGCGACAGCTC ACGAACTTGACTCAGCCTCA CYR61 DQ239628 286–354 ATCGTCCAAACAACTTCGTG GGTAACGCGTGTGGAGATAC IL-1 NM_001009465 353–473 CGATGAGCTTCTGTGTGATG ... NM_001009465 353–473 CGATGAGCTTCTGTGTGATG CTGTGAGAGGAGGTGGAGAG IL-6 NM_001009392 598–705 CGCAAAGGTTATCATCATCC CCCAGGAACTACCACAATCA IL-8 NM_001009401 438–520 CCTCAGTAAAGATGCCAA...
Ngày tải lên: 12/08/2014, 14:20
Báo cáo Y học: Recombinant human glucose-6-phosphate dehydrogenase Evidence for a rapid-equilibrium random-order mechanism potx
... of clinically significant Glc6P dehydrogenase mutants. Furthermore, our recently solved crystallographic structure of human Glc6P dehydrogenase [16,17] clearly vindicates earlier claims that each ... BamHI/SalI-cleaved pTrc99A. The recombinant plasmid, designated pTrc/ G6PD, was shown by dideoxy sequencing to contain the complete human Glc6P dehydrogenase coding sequence. Expression and pu...
Ngày tải lên: 08/03/2014, 22:20
Báo cáo y học: "A human functional protein interaction network and its application to cancer data analysis" potx
... constructed a protein functional interaction network by extending curated pathways with non- curated sources of information, including protein- protein interactions, gene coexpression, protein domain interaction, ... annotated in pathways by defining a FI as an interaction in which two proteins are involved in the same reaction as input, catalyst, activator and/or inhibitor, or as...
Ngày tải lên: 09/08/2014, 20:22
Báo cáo y học: "The human anti-IL-1β monoclonal antibody ACZ885 is effective in joint inflammation models in mice and in a proof-of-concept study in patients with rheumatoid arthritis" doc
... multicentre study was conducted in accordance with GCP (Good Clinical Practice) guidelines and the Helsinki Declaration in three countries in Europe. The study protocol and patient informed consent ... significantly prolong IL-1 activity. Proof-of-concept clinical trial in patients with RA A proof-of-concept study to explore safety and tolerability, pharmacokinetics and pharmacodynami...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: "Vitamin D receptor gene polymorphisms and susceptibility of hand osteoarthritis in Finnish wome" pdf
... polyarticular involve- ment being symmetry, clustering by row, and clustering by ray (in descending order of importance). While OA in a specific joint (monoarticular OA) may result from acute ... hormone therapy, and smoking history. Regulation of intracellular calcium plays a key role in hyperten- sion, insulin resistance, and obesity [41]. A protective effect of dietary calcium in p...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: "Effect of Zofenopril on regeneration of sciatic nerve crush injury in a rat model" doc
... Z. Discussion Severe anatomical and functional disorders can be seen after peripheral nerve injury. This type of injury frequency is increasing with technology in industrialized societies. Nerve injuries ... sulfhydryland nonsulfhydryl-containing ACE inhibitors. J Cardiovasc Pharmacol 1992, 19:330-340. 25. Mak IT, Freedman AM, Dickens BF, Weglicki WB: Protective effects of sulfhydryl-con...
Ngày tải lên: 10/08/2014, 10:20
Báo cáo y học: "Simvastatin protects bladder and renal functions following spinal cord injury in rats." ppsx
... spinal cord [29]. Spinal cord contusion injury was induced by a controlled contusion injury (CCI) device described by Bilgen [30]. Injury was made with 2 mm diameter impactor at 1.5 m/s velocity ... overactivity by arginase inhibitor in rats with chronic spinal cord injury. Urology 2008, 72:696-700. 46. Kim D, Sands JM, Klein JD: Changes in renal medullary transport proteins d...
Ngày tải lên: 11/08/2014, 03:20
Báo cáo y học: "Simvastatin protects bladder and renal functions following spinal cord injury in rats" potx
... are secondary events associated with spinal cord injury (SCI) in humans. These secondary events not only compromise quality of life but also delay overall recovery from SCI pathophysiology. Furthermore, ... SCI-induced renal caspase-3 activity was significantly decreased in the simvastatin group indicating the ability of simvastatin to reduce the renal tubular apoptosis. Conclusion:...
Ngày tải lên: 11/08/2014, 06:22