Báo cáo y học: "Cardiorespiratory effects of spontaneous breathing in two different models of experimental lung injury: a randomized controlled trial" doc
Báo cáo y học: "Cardiorespiratory effects of spontaneous breathing in two different models of experimental lung injury: a randomized controlled trial" doc
... 12.2 Pre-acute lung injury (ALI) (Table S1 in additional data file) was tested only against baseline ALI (BL-ALI). Post hoc testing was always performed if a significant F ratio for a factor or the interaction ... SB) spontaneous breathing. HCl-ALI, hydrochloric acid- induced acute lung injury; OA-ALI, oleic acid-induced acute lung injury; V DS , deadspace ventilation. VQ...
Ngày tải lên: 13/08/2014, 11:23
Báo cáo y học: "Group cognitive behavioural therapy for women with depression: pilot and feasibility study for a randomised controlled trial using mixed meth" pptx
... issues of acceptability and feasibility. Interviews were conducted with all participants at baseline and at 3 and 6 months although detailed qualitative analysis was based on a purposive sample of ... imbalance was for occupat ional status, with the intervention arm including more employed women. The arms were also very similar in all the clinical variables with only a mar- ginally...
Ngày tải lên: 11/08/2014, 15:22
Báo cáo y học: "Intensive care diaries reduce new onset post traumatic stress disorder following critical illness: a randomised, controlled trial" docx
... Patient diary guidelines. This contains the guidelines used in the study to ensure all study centres wrote diaries in a similar way. Abbreviations ANOVA: univariate analysis of variance; CBT: ... the database then locked. Data analysis was performed bli nd using coded data and the code only broken once the analysis was complete. Statistics The statistical analysis was performed by one...
Ngày tải lên: 13/08/2014, 21:21
Báo cáo y học: "Cardiorespiratory effects of venous lipid micro embolization in an experimental model of mediastinal shed blood reinfusion" pptx
... behind the acute increase in PVR RadioactivityFigure 8 Radioactivity. Mean amount of radioactivity in the carotid artery at each sampling time, as a measure of the amount of emboli passing ... capillaries can play a role in the pathophysiology. A vascular wall response, leading to a spasm, could also be involved; triolein itself may have triggered such a spasm. Several...
Ngày tải lên: 10/08/2014, 10:20
Tài liệu Báo cáo Y học: Soluble silk-like organic matrix in the nacreous layer of the bivalve Pinctada maxima A new insight in the biomineralization field pptx
... matrix from carbonate biomineral as a regulator of mineralization. In Chemical Aspects of Regulation of Mineralization (Sikes,C.S.& Wheeler, A. P., eds). University of South Alabama Publication Services, ... 23, 175–179. 45. Balmain, J., Hannoyer, B. & Lopez, E. (1999) Fourier transform infrared spectroscopy (FTIR) and X-ray diffraction analyses of mineral and organic ma...
Ngày tải lên: 21/02/2014, 01:21
Báo cáo y học: "Serum keratan sulfate transiently increases in the early stage of osteoarthritis during strenuous running of rats: protective effect of intraarticular hyaluronan injection" docx
... S, Nawata M, Kawaguchi A, Okabe T, Takaoka K, Tsuch- iya T, Nakaoka R, Masuda H, Miyazaki K: Serum keratan sulfate is a promising marker of early articular cartilage breakdown. Rheumatology (Oxford) ... defects of rat articular carti- lage [6]. In normal articular cartilage, hyaluronan was stained mainly around the chondrocytes. During repair, strong hyaluro- nan staining was observe...
Ngày tải lên: 09/08/2014, 10:22
Báo cáo y học: "Neutrophils exhibit distinct phenotypes toward chitosans with different degrees of deacetylation: implications for cartilage repair" pdf
... Ueno H, Yamada H, Tanaka I, Kaba N, Matsuura M, Okumura M, Kadosawa T, Fujinaga T: Accelerating effects of chitosan for healing at early phase of experimental open wound in dogs. Biomaterials 1999, ... specificity of partially N- acetylated chitosans. Biochim Biophys Acta 1996, 1291:5-15. 9. Sashiwa H, Saimoto H, Shigemasa Y, Ogawa R, Tokura S: Lys- ozyme susceptibility of part...
Ngày tải lên: 09/08/2014, 14:21
Báo cáo y học: "Hypertrophy is induced during the in vitro chondrogenic differentiation of human mesenchymal stem cells by bone morphogenetic protein-2 and bone morphogenetic protein-4 gene transfer" pps
... Sense: ACAGATGATGACACTGCCACC Antisense: CATAGTAGAGATATGGAGTGCTGC 55 324 35 Internal control EF1α Sense: AGGTGATTATCCTGAACCATCC Antisense: AAAGGTGGATAGTCTGAGAAGC 54 234 25 rt: primer pairs, that have ... ACGCCGACCAAGGAAAACTC Antisense: GTCCATAAACCACACTATCACCTCG 51 483 35 ALP (rt) Sense: TGGAGCTTCAGAAGCTCAACACCA Antisense: ATCTCGTTGTCTGAGTACCAGTCC 51 454 IHH Sense: GAGGAGTCCCTGCATTATGA Antisens...
Ngày tải lên: 09/08/2014, 14:22
Báo cáo y học: " Conserved charged amino acid residues in the extracellular region of sodium/iodide symporter are critical for iodide transport activity" potx
... dithiothreitol). Radioactivities of lysatesweredeterminedbyaCobraIIauto-gamma counter (Packard BioScience, Dreieich, Germany). b- Galactosidase activities of cell lysates were analyzed by mixing cell lysates ... hours later, the iodide uptake activity was analyzed by steady-state iodide uptake assay and the transfection efficiency was monitored by b-galactosidase assay. As shown in Figu...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: " Mixed states vs. pure mania in the french sample of the EMBLEM study: results at baseline and 24 months – European mania in bipolar longitudinal evaluation of medication" ppsx
... atypical antipsychotic treatment maintained it, 36% for anticonvulsants, 45% for lithium and 20% for typical antipsychotics. 35% of the patients taking antide- pressants at baseline maintained ... could partly explain the high proportion of treatment combinations. The study design suggested including an equivalent number of patients taking olanzapine and other oral anti- manic drugs. An...
Ngày tải lên: 11/08/2014, 17:20