Báo cáo y học: "Cardiorespiratory effects of spontaneous breathing in two different models of experimental lung injury: a randomized controlled trial" doc
Báo cáo y học: "Cardiorespiratory effects of spontaneous breathing in two different models of experimental lung injury: a randomized controlled trial" doc
... 12.2Pre-acute lung injury (ALI) (Table S1 in additional data file) was tested only against baseline ALI (BL-ALI). Post hoc testing was always performed if a significant F ratio for a factor or the interaction ... SB) spontaneous breathing. HCl-ALI, hydrochloric acid-induced acute lung injury; OA-ALI, oleic acid-induced acute lung injury; VDS, deadspace ventilation.VQ A Open AccessAvailable online ... fraction,and increases EELV in both models of ALI.ALI: acute lung injury; APRV: airway pressure release ventilation; ARDS: acute respiratory distress syndrome; BL-ALI: baseline acute lung injury;...
- 13
- 305
- 0
Báo cáo y học: "Group cognitive behavioural therapy for women with depression: pilot and feasibility study for a randomised controlled trial using mixed meth" pptx
... issues of acceptabilityand feasibility. Interviews were conducted with all participants at baseline and at 3 and 6 months although detailedqualitative analysis was based on a purposive sample of ... imbalancewas for occupat ional status, with the intervention armincluding more employed women. The arms were alsovery similar in all the clinical variables with only a mar-ginally increased ... emade widely available rather than being equivalent toindividual CBT from a trained therapist.Facilitators and groups: A pair of trained facilitatorsdelivered the intervention. There was a...
- 11
- 486
- 0
Báo cáo y học: "Intensive care diaries reduce new onset post traumatic stress disorder following critical illness: a randomised, controlled trial" docx
... Patient diary guidelines. This contains the guidelinesused in the study to ensure all study centres wrote diaries in a similarway.AbbreviationsANOVA: univariate analysis of variance; CBT: ... the database then locked.Data analysis was performed bli nd using coded data andthe code only broken once the analysis was complete.StatisticsThe statistical analysis was performed by one of ... and interventio n groups toensure adequate randomisation. T tests and MannWhitney U tests were employed when comparing two groups and univariate analysis of variance (ANOVA)using the F statistic...
- 10
- 487
- 0
Báo cáo y học: "Cardiorespiratory effects of venous lipid micro embolization in an experimental model of mediastinal shed blood reinfusion" pptx
... behind the acute increase in PVRRadioactivityFigure 8Radioactivity. Mean amount of radioactivity in the carotid artery at each sampling time, as a measure of the amount of emboli passing ... capillaries can play a role in the pathophysiology. A vascular wall response, leadingto a spasm, could also be involved; triolein itself may havetriggered such a spasm. Several authors have suggestedthat ... blood gas analysis and capnography. The first dashed line indicates the infusion of shed blood surrogate. The second dashed line indicates the infusion of epinephrine and Ringer's lactate.Journal...
- 9
- 362
- 0
Tài liệu Báo cáo Y học: Soluble silk-like organic matrix in the nacreous layer of the bivalve Pinctada maxima A new insight in the biomineralization field pptx
... matrixfrom carbonate biomineral as a regulator of mineralization. In Chemical Aspects of Regulation of Mineralization (Sikes,C.S.&Wheeler, A. P., eds). University of South Alabama PublicationServices, ... 23,175–179.45. Balmain, J., Hannoyer, B. & Lopez, E. (1999) Fourier transforminfrared spectroscopy (FTIR) and X-ray diffraction analyses of mineral and organic matrix during heating of mother of pearl(nacre) ... expressed as a molepercent, represent the average of at least three independentdeterminations. The amount of protein in each extract wascalculated from the amino acids’ molar yields.Glycosaminoglycan...
- 10
- 731
- 0
Báo cáo y học: "Serum keratan sulfate transiently increases in the early stage of osteoarthritis during strenuous running of rats: protective effect of intraarticular hyaluronan injection" docx
... S, Nawata M, Kawaguchi A, Okabe T, Takaoka K, Tsuch-iya T, Nakaoka R, Masuda H, Miyazaki K: Serum keratan sulfateis a promising marker of early articular cartilage breakdown.Rheumatology (Oxford) ... defects of rat articular carti-lage [6]. In normal articular cartilage, hyaluronan was stainedmainly around the chondrocytes. During repair, strong hyaluro-nan staining was observed in loose ... every week by HPLC. The effect of weeklyknee injection of hyaluronan was also investigated.Results Cartilage surfaces stained with India ink becameirregular, metachromasia by safranin-O staining...
- 8
- 370
- 0
Báo cáo y học: "Neutrophils exhibit distinct phenotypes toward chitosans with different degrees of deacetylation: implications for cartilage repair" pdf
... Ueno H, Yamada H, Tanaka I, Kaba N, Matsuura M, Okumura M,Kadosawa T, Fujinaga T: Accelerating effects of chitosan forhealing at early phase of experimental open wound in dogs.Biomaterials 1999, ... specificity of partially N-acetylated chitosans. Biochim Biophys Acta 1996, 1291:5-15.9. Sashiwa H, Saimoto H, Shigemasa Y, Ogawa R, Tokura S: Lys-ozyme susceptibility of partially deacetylated ... Production of superoxide anions was evaluated using the cytochrome creduction assay. Degranulation was determined by evaluatingthe release of myeloperoxidase and lactoferrin. Theinternalization of...
- 10
- 414
- 0
Báo cáo y học: "Hypertrophy is induced during the in vitro chondrogenic differentiation of human mesenchymal stem cells by bone morphogenetic protein-2 and bone morphogenetic protein-4 gene transfer" pps
... Sense: ACAGATGATGACACTGCCACCAntisense: CATAGTAGAGATATGGAGTGCTGC55 324 35Internal controlEF1α Sense: AGGTGATTATCCTGAACCATCCAntisense: AAAGGTGGATAGTCTGAGAAGC54 234 25rt: primer pairs, that have ... ACGCCGACCAAGGAAAACTCAntisense: GTCCATAAACCACACTATCACCTCG51 483 35ALP (rt) Sense: TGGAGCTTCAGAAGCTCAACACCAAntisense: ATCTCGTTGTCTGAGTACCAGTCC51 454IHH Sense: GAGGAGTCCCTGCATTATGAAntisense: CAGGAAAATGAGCACATCGC54 321 ... wasadministered as shown by staining with alcian blue, COL II andCS4 and the quantitative GAG assay, indicating increasedGAG levels at days 14 and 21 in the BMP-2-modified aggre-gates. Notably, chondrogenic...
- 15
- 830
- 0
Báo cáo y học: " Conserved charged amino acid residues in the extracellular region of sodium/iodide symporter are critical for iodide transport activity" potx
... dithiothreitol). Radioactivities of lysatesweredeterminedbyaCobraIIauto-gammacounter (Packard BioScience, Dreieich, Germany). b-Galactosidase activities of cell lysates were analyzed bymixing cell lysates ... hours later, the iodide uptake activity wasanalyzed by steady-state iodide uptake assay and thetransfection efficiency was monitored by b-galactosidaseassay. As shown in Figure 3, wild-type NIS-expressingcells ... Faham S, Watanabe A, Besserer GM, Cascio D, Specht A, Hirayama BA,Wright EM, Abramson J: The crystal structure of a sodium galactosetransporter reveals mechanistic insights into Na+/sugar symport....
- 9
- 398
- 0
Báo cáo y học: " Mixed states vs. pure mania in the french sample of the EMBLEM study: results at baseline and 24 months – European mania in bipolar longitudinal evaluation of medication" ppsx
... atypical antipsychotic treatment maintainedit, 36% for anticonvulsants, 45% for lithium and 20% fortypical antipsychotics. 35% of the patients taking antide-pressants at baseline maintained ... could partly explain thehigh proportion of treatment combinations.The study design suggested including an equivalentnumber of patients taking olanzapine and other oral anti-manic drugs. Analysis ... 4):1-50.2. National Institute for health and Clinical Excellence (NICE): Themanagement of bipolar disorder in adults, children and ado-lescents, in primary and secondary care. NICE Clinical Guideline2006,...
- 9
- 482
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật