Báo cáo y học: "Analysis of N-terminal pro-B-type natriuretic peptide and cardiac index in multiple injured patients: a prospective cohort study" docx

Báo cáo y học: "Analysis of N-terminal pro-B-type natriuretic peptide and cardiac index in multiple injured patients: a prospective cohort study" docx

Báo cáo y học: "Analysis of N-terminal pro-B-type natriuretic peptide and cardiac index in multiple injured patients: a prospective cohort study" docx

... normal as an indicator for intravascular vol- ume loss and therefore as an initial marker of bleeding. Stewart and colleagues [4] recently analyzed BNP and transthoracic echocardiogram in trauma ... 5 Research Analysis of N-terminal pro-B-type natriuretic peptide and cardiac index in multiple injured patients: a prospective cohort study Chlodwig Kirchho...
Ngày tải lên : 13/08/2014, 11:22
  • 8
  • 291
  • 0
Báo cáo y học: "Impact of emergency intubation on central venous oxygen saturation in critically ill patients: a multicenter observational study" potx

Báo cáo y học: "Impact of emergency intubation on central venous oxygen saturation in critically ill patients: a multicenter observational study" potx

... statistical analysis. JR, HP, JLN, and IA recruited patients. All authors read and approved the final manuscript. Acknowledgements The study was funded by an institutional grant of the Departmento ... divergent changes in DO 2 and VO 2 can be induced by emergency intubation and could probably explain the variable effect on oxygen extraction. Our results demonstrate that in the...
Ngày tải lên : 13/08/2014, 16:20
  • 6
  • 284
  • 0
Báo cáo y học: " Subjective memory complaints, vascular risk factors and psychological distress in the middle-aged: a cross-sectional study" pptx

Báo cáo y học: " Subjective memory complaints, vascular risk factors and psychological distress in the middle-aged: a cross-sectional study" pptx

... is uncertainty regarding the significance of SMC. They may be an early marker of cognitive decline with an underly- ing pathological basis, a feature of normal ageing and/ or a reflection of psychological distress. Cross-sectional ... population. Methods: A cross-sectional analysis of baseline data from the 45 and Up Study was performed. This is a cohort study of peop...
Ngày tải lên : 11/08/2014, 15:22
  • 7
  • 421
  • 0
Báo cáo y học: "Analysis of arterial intimal hyperplasia: review and hypothesis" pot

Báo cáo y học: "Analysis of arterial intimal hyperplasia: review and hypothesis" pot

... 44:907-919. 20. Miyao Y, Kugiyama K, Kawano H, Motoyama T, Ogawa H, Yoshimura M, Sakamoto T, Yasue H: Diffuse intimal thickening of coronary arteries in patients with coronary spastic angina. J Am Coll Car- diol ... Ishizaka M, Taka- hashi R, Azuma H: Accumulated endogenous nitric oxide syn- thase inhibitors, enhanced arginase activity, attenuated dimethylarginine dimethylaminohydrolase...
Ngày tải lên : 13/08/2014, 16:21
  • 20
  • 287
  • 0
Báo cáo y học: "Analysis of the Macaca mulatta transcriptome and the sequence divergence between Macaca and human" ppt

Báo cáo y học: "Analysis of the Macaca mulatta transcriptome and the sequence divergence between Macaca and human" ppt

... -CCCT- CACTAAAGGGAACAAAA (the sequencing primer) and 5' - CACTATAGGGCGAATTGGGTA; for the Invitrogen pDONR222 vector: 5' -GACGTTGTAAAACGACGGC (the sequencing primer) and 5' -GCCAGGAAACAGCTATGACC. PCR ... 5'-CAAAGCCATCAGACAGCAGA-3', 5'-GAGAC- CAGGAAAGTCGAAGG-3'; CB552531: 5'-CTGGAATAAGGCCAGAAGCA-3', 5'-ATTCCT- CAGGTCTGGTGGAG-3'; CX07859...
Ngày tải lên : 14/08/2014, 14:21
  • 16
  • 322
  • 0
Báo cáo y học: "Effect of phospholipase A2 inhibitory peptide on inflammatory arthritis in a TNF transgenic mouse model: a time-course ultrastructural study" pptx

Báo cáo y học: "Effect of phospholipase A2 inhibitory peptide on inflammatory arthritis in a TNF transgenic mouse model: a time-course ultrastructural study" pptx

... Murakami M, Kuwata H, Amakasu Y, Shimbara S, Nakatani Y, Atsumi G, Kudo I: Prostaglandin E2 amplifies cytosolic phos- pholipase A2 - and cyclooxygenase-2-dependent delayed prostaglandin E2 generation ... instructions. Statistical analysis Statistical analyses were performed using GraphPad Prism software to calculate the means and SEMs. Group means were compared by using one-way analys...
Ngày tải lên : 09/08/2014, 01:23
  • 13
  • 381
  • 0
Báo cáo y học: "Activation of transforming growth factor-β1 and early atherosclerosis in systemic lupus erythematosus" pptx

Báo cáo y học: "Activation of transforming growth factor-β1 and early atherosclerosis in systemic lupus erythematosus" pptx

... phenotype, in particular inflammatory disease activity, cumulative organ damage and early atherosclerosis. Materials and methods Patients and control individuals We recruited female Caucasian patients, ... most of the laboratory assays, helped in statisti- cal analysis of the data and helped to draft the manuscript. YA obtained consent from patients and collected the samples...
Ngày tải lên : 09/08/2014, 08:22
  • 7
  • 347
  • 0
Báo cáo y học: " Detection of HIV-1 RNA/DNA and CD4 mRNA in feces and urine from chronic HIV-1 infected subjects with and without anti-retroviral therapy" pptx

Báo cáo y học: " Detection of HIV-1 RNA/DNA and CD4 mRNA in feces and urine from chronic HIV-1 infected subjects with and without anti-retroviral therapy" pptx

... are very complex and so far no sensitive methods are available for detection of viral and human RNA/DNA in human feces, we have initially tested assay sensitivity for nucleic acid isolation and ... with and without anti-retroviral therapy Ayan K Chakrabarti, Lori Caruso, Ming Ding, Chengli Shen, William Buchanan, Phalguni Gupta, Charles R Rinaldo and Yue Chen* Address: Departm...
Ngày tải lên : 10/08/2014, 05:21
  • 11
  • 336
  • 0
Báo cáo y học: "Estimation of lung vital capacity before and after coronary artery bypass grafting surgery: a comparison of incentive spirometer and ventilometry" pps

Báo cáo y học: "Estimation of lung vital capacity before and after coronary artery bypass grafting surgery: a comparison of incentive spirometer and ventilometry" pps

... sensibility and specificity has a great value for clinical practice, mainly when these techniques can be applied in a practical way, in bed and at low cost. In literature there is an array of researches ... vital capacity before and after coronary artery bypass grafting surgery: a comparison of incentive spirometer and ventilometry Areli Cunha Pinheiro 1 , Michelli Chr...
Ngày tải lên : 10/08/2014, 09:21
  • 5
  • 342
  • 0
Báo cáo y học: "Estimation of stature from the foot and its segments in a sub-adult female population of North India" pps

Báo cáo y học: "Estimation of stature from the foot and its segments in a sub-adult female population of North India" pps

... 15 of Government Schools located in villages Nanakpur, Marranwala and Bassolan of Tehsil Kalka, District Panchkula in Haryana state of North India for allowing data collection. Thanks are also ... most accurate estimation of stature by linear regression analysis. Although the SEE value is minimal and the predictive accuracy (R 2 ) maximum for T1, accuracy of all measureme...
Ngày tải lên : 10/08/2014, 21:24
  • 33
  • 480
  • 0