Báo cáo y học: "Partial pressure of end-tidal carbon dioxide successful predicts cardiopulmonary resuscitation in the field: a prospective observational study" potx

Báo cáo y học: "Partial pressure of end-tidal carbon dioxide successful predicts cardiopulmonary resuscitation in the field: a prospective observational study" potx

Báo cáo y học: "Partial pressure of end-tidal carbon dioxide successful predicts cardiopulmonary resuscitation in the field: a prospective observational study" potx

... out -of- hospital cardiac arrest. The patients were intubated and measurements of end-tidal carbon dioxide taken. Data according to the Utstein criteria, demographic information, medical data, and partial pressure ... participated in designing the study, and collection and statistical analysis of data. PK participated in designing the study and helped to draft the ma...

Ngày tải lên: 13/08/2014, 11:22

13 248 0
Báo cáo y học: "Partial pressure of end-tidal carbon dioxide predicts successful cardiopulmonary resuscitation in the field" docx

Báo cáo y học: "Partial pressure of end-tidal carbon dioxide predicts successful cardiopulmonary resuscitation in the field" docx

... conditions has a high failure rate and disproportionate airway injury. The alternatives of a laryngeal mask airway or even a facial mask incorporating a mainstream carbon dioxide sensor may be utilized. ... ventricular tachycardia. As the authors pinpoint, PetCO 2 has evolved into a technically facile and singularly useful monitor to guide cardiopulmonary resuscitation...

Ngày tải lên: 13/08/2014, 11:23

2 217 0
Báo cáo Y học: Amphipathic property of free thiol group contributes to an increase in the catalytic efficiency of carboxypeptidase Y pot

Báo cáo Y học: Amphipathic property of free thiol group contributes to an increase in the catalytic efficiency of carboxypeptidase Y pot

... hydrophobicity and Gly, Ser, Asp and His mutants to provide hydrophilicity. The catalytic roles of Cys341 in carboxypeptidase Y are examined by comparing the kinetic parameters of the Cys341 mutant enzymes. MATERIALS ... Hercules, CA, USA. Bistris was obtained from Nacalai Tesque, Kyoto, Japan. All other chemicals were of reagent grade and obtained locally. Strains and plasmid...

Ngày tải lên: 08/03/2014, 23:20

6 459 0
Báo cáo y học: "Detailed analysis of 15q11-q14 sequence corrects errors and gaps in the public access sequence to fully reveal large segmental duplications at breakpoints for Prader-Willi, Angelman, and inv dup(15) syndromes" pdf

Báo cáo y học: "Detailed analysis of 15q11-q14 sequence corrects errors and gaps in the public access sequence to fully reveal large segmental duplications at breakpoints for Prader-Willi, Angelman, and inv dup(15) syndromes" pdf

... GTCGGCTCCCAACTTCGT, and CTTTGGACACG- GCCTCC, respectively), S (ACGTGAGTTTGTTCAAGCAA- GTC, CTTCTTCCCAGCATGTCACAGAT, and CCGCCTC- CACAAGTT) and F (TGAAGTGTGGGTCATTTCCTAAGC, GGCAGACACAGCTGGGATAG, and CTACAGCCAT- GAGCTACTG). PCRs ... primers and annealing temperature (t) as follows: B/Q (TGGAGCCAGTCCGAGATAGG, GCTTCAC- CACCACGACTGG, t = 63°C), M /A& apos; (CAAACTGTAATGT- GGCATCC, CAATGGTGCCTATCCCT...

Ngày tải lên: 14/08/2014, 07:21

16 384 0
Báo cáo y học: "Nonrandom divergence of gene expression following gene and genome duplications in the flowering plant Arabidopsis thaliana" doc

Báo cáo y học: "Nonrandom divergence of gene expression following gene and genome duplications in the flowering plant Arabidopsis thaliana" doc

... the latter). Additional data files The following additional data are available with the online version of this paper. Additional data file 1 is a description of dataset 1. Additional data file 2 is a description ... commu- nication, carbohydrate and lipid metabolism, and for genes with hydrolase activity (Additional data file 3). Interestingly, genes of many of these classes...

Ngày tải lên: 14/08/2014, 16:21

11 274 0
Báo cáo y học: "Urinary interleukin-18 does not predict acute kidney injury after adult cardiac surgery: a prospective observational cohort study" docx

Báo cáo y học: "Urinary interleukin-18 does not predict acute kidney injury after adult cardiac surgery: a prospective observational cohort study" docx

... urinary IL-18 concentration and urinary IL-18/urinary creatinine ratio in relation to the postoperative development of acute kidney injury defined as an increase in serum creatinine of greater ... possible that urinary IL- 18 would be of greater value in patients at increased risk of developing AKI. In the absence of adjudication of aetiology, the sustained increase...

Ngày tải lên: 13/08/2014, 11:22

8 304 0
Báo cáo y học: " Delayed neuropsychological sequelae after carbon monoxide poisoning: predictive risk factors in the " potx

Báo cáo y học: " Delayed neuropsychological sequelae after carbon monoxide poisoning: predictive risk factors in the " potx

... Personality changes Dyspraxia Anxiety Dysphasia Extreme emotional lability Ataxia Psychosis Postural instability Depression Vertigo Mania Cortical blindness Insomnia Hearing loss, tinnitus Chorea EEG ... patient. A Parkinson-li ke syndrome wi th severe cognitive i mpairment and urinary incontinence developed in another case (a 66 year s-old male present- ing coma and haemodynamic instabi...

Ngày tải lên: 13/08/2014, 23:20

8 238 0
Báo cáo Y học: Identification of novel membrane proteins by searching for patterns in hydropathy profiles potx

Báo cáo Y học: Identification of novel membrane proteins by searching for patterns in hydropathy profiles potx

... was able to detect 100% of known GlyR and AChR across a range of species. The accuracy and sensitivity of the search strategy were tested by applying it to a custom database containing GABA A receptor ... Most membrane-associated domains produce an easily identified peak in the hydropathy profile of the polypeptide. Standard software tools are available that can identify...

Ngày tải lên: 17/03/2014, 23:20

7 407 0
Báo cáo Y học: Proteolytic action of duodenase is required to induce DNA synthesis in pulmonary artery fibroblasts A role for phosphoinositide 3-kinase pot

Báo cáo Y học: Proteolytic action of duodenase is required to induce DNA synthesis in pulmonary artery fibroblasts A role for phosphoinositide 3-kinase pot

... each of these pathways has a modulatory r ather than a mandatory role to play in mediating the proliferative response. In contrast, a recent report has shown that tryptase induces DNA synthesis in canine ... trypsin cleaves and activates PAR2. As duodenase is capable of cleaving certain substrates with trypsin-like primary specificity, we initially hypothesized that induction...

Ngày tải lên: 24/03/2014, 03:21

10 437 0
Báo cáo y học: "Decreased levels of soluble amyloid β-protein precursor and β-amyloid protein in cerebrospinal fluid of patients with systemic lupus erythematosus" ppsx

Báo cáo y học: "Decreased levels of soluble amyloid β-protein precursor and β-amyloid protein in cerebrospinal fluid of patients with systemic lupus erythematosus" ppsx

... used as a detection antibody. The concentration of APP in samples of CSF was calculated from the linear part of a standard curve. In contrast to other analyses, only 86 SLE patients were analyzed ... SLE and age-matched controls were evaluated clinically, with magnetic resonance imaging of the brain and CSF analyses. Levels of tau, amyloid precursor protein (APP), β-am...

Ngày tải lên: 09/08/2014, 01:23

8 343 0
Từ khóa:
w