Báo cáo y học: "Acute kidney injury in intensive care unit patients: a comparison between the RIFLE and the Acute Kidney Injury Network classifications" potx

... correlate with synovial lining cell hyperplasia. A study by Bohm and co-workers [12] described the expres- sion of ADAM15 in RA and OA synovial tissues by immunohis- tochemistry and in situ hybridization, ... hematoxylin and eosin were analyzed by light microscopy according to our grading system of syno- vial lining cell hyperplasia, cellular infiltration and fibrosi...

Ngày tải lên: 09/08/2014, 07:20

... article Osteogenic protein 1 in synovial fluid from patients with rheumatoid arthritis or osteoarthritis: relationship with disease and levels of hyaluronan and antigenic keratan sulfate Susan Chubinskaya 1, 2 , ... osteogenic protein 1 (OP -1) in SF from patients with rheumatoid arthritis (RA) or with osteoarthritis (OA) and...

Ngày tải lên: 09/08/2014, 08:22

... article Spectrocolorimetric assessment of cartilage plugs after autologous osteochondral grafting: correlations between color indices and histological findings in a rabbit model Koji Hattori 1,2 , Kota ... Kota Uematsu 2 , Yohei Tanikake 2 , Takashi Habata 2 , Yasuhito Tanaka 2 , Hiroshi Yajima 2 and Yoshinori Takakura 2 1 Department of DAIWA HOUSE In...

Ngày tải lên: 09/08/2014, 10:21

... analysis. Analysis was performed by analysis of variance (ANOVA), multivariate ANOVA and repeated measures ANOVA, as indicated. Factor analysis was utilized to detect relationships between positive autonomic ... of mild, possibly subclinical autonomic dysfunction in pSS. Heart rate variability: time domain measures There was a relative tachycardia in pSS patients (Figure 2b) as a...

Ngày tải lên: 09/08/2014, 10:23

... 5'-AAGTGGGCCTTTAATCTCTACTATAGTGAGTCGTATTA-3' siRNA4 5'-AAGCTCATGATGTTCTCATCCTATAGTGAGTCGTATTA-3' 5'-AAGGATGAGAACATCATGAGCTATAGTGAGTCGTATTA-3' siRNA5 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA-3' ... 5'AAGGTCAAGTGGATCCTGTCCTATAGTGAGTCGTATTA3' siRNA2 5'-AAGGTGAACTTGGTCTGGGCCTATAGTGAGTCGTATTA3' 5'-AAGGCCCAGACCAAGTTCACCTATAGTGAGTCGTAT...

Ngày tải lên: 09/08/2014, 10:23

... of animal models with fever and infection, call into question the routine practice of treating fever in critically ill patients. Keywords fever, heat shock proteins, intensive care unit, nuclear factor-κB, ... the intensive care unit (ICU) with severe sepsis, the incidence of fever is more than 90% [2]. As there is variation in the incidence of reported fevers, the etiol...

Ngày tải lên: 12/08/2014, 19:22

... operating characteristic analysis of pre -admission HRQOL and APACHE II scores in relation to mortalityReceiver operating characteristic analysis of pre -admission HRQOL and APACHE II scores in relation ... advantages of using pre -admission HRQOL as a predictor of mortality are that it is easily obtained and available as soon as the patient, or a proxy (close family membe...

Ngày tải lên: 13/08/2014, 08:20

... http://ccforum.com/content/11/4/R85 Page 1 of 8 (page number not for citation purposes) Vol 11 No 4 Research Safety of rFVIIa in hemodynamically unstable polytrauma patients with traumatic brain injury: post hoc analysis of 30 ... deduced from studies in hemodynamically stable patients with TBI. A dose- escalation study aimed primarily at assessin...

Ngày tải lên: 13/08/2014, 08:20

... ICU, and it is appropriate to develop training programmes where those capabilities are enhanced and trained. Letter Evidence-based approach to intensive care unit management: need for improvement Anders ... activities, with preparedness for policy changes and capacity for multiprofessional liaison between physicians, nursing staff and personnel from other specialities. T...

Ngày tải lên: 13/08/2014, 08:21

... 1 of 8 (page number not for citation purposes) Vol 12 No 3 Research Mild therapeutic hypothermia shortens intensive care unit stay of survivors after out -of- hospital cardiac arrest compared to ... intensive care unit (ICU) length of stay and ventilator time in patients after cardiac arrest were found to be either early death dur- ing ICU sta...

Ngày tải lên: 13/08/2014, 11:22

... [4]. Commentary Opioid-induced constipation in intensive care patients: relief in sight? Daniel Chappell, Markus Rehm and Peter Conzen Clinic of Anaesthesiology, Ludwig-Maximilians University, Nussbaumstrasse ... alterations in pharmacokinetics [8]. Only about 4% of intensive care units currently have guidelines for treating constipation [5]. Various laxative interventio...

Ngày tải lên: 13/08/2014, 11:22

... http://ccforum.com/content/12/4/R110 Page 1 of 8 (page number not for citation purposes) Vol 12 No 4 Research Acute kidney injury in intensive care unit patients: a comparison between the RIFLE and the Acute Kidney Injury Network ... Warnock DG, Levin A, Acute Kidney Injury Network: Acute Kidney Injury Network: report of an initiative to im...

Ngày tải lên: 13/08/2014, 11:22

... extubation. In the primary analysis, patients who underwent tracheostomy were analysed as having been extu- bated at that point (see discussion for rationale), but in a sup- plementary analysis ... into which a card indi- cating patient allocation had been placed according to a computer-generated random-number sequence. Dexmedeto- midine was administered intravenously as a mainten...

Ngày tải lên: 13/08/2014, 16:20

... the original article. Reference 1. Bikker IG, van Bommel J, Reis Miranda D, Bakker J and Gommers D: End-expiratory lung volume during mechanical ventilation: a comparison with reference values and the ... mechanical ventilation: a comparison with reference values and the effect of positive end-expiratory pressure in intensive ca...

Ngày tải lên: 13/08/2014, 20:21

... Access Respiratory support withdrawal in intensive care units: families, physicians and nurses views on two hypothetical clinical scenarios Renata RL Fumis 1*† , Daniel Deheinzelin 2† Abstract Introduction: ... limiting life -support therapy with terminally ill patients and favored family participation. In decisions concerning an incompetent patient, phys...

Ngày tải lên: 14/08/2014, 07:21