Báo cáo y học: "Norepinephrine to increase blood pressure in endotoxaemic pigs is associated with improved hepatic mitochondrial respiration" doc

Báo cáo y học: "Interleukin-12 Peripheral Blood Levels in Asthmatic Children" pptx

Báo cáo y học: "Interleukin-12 Peripheral Blood Levels in Asthmatic Children" pptx

... peripheral blood levels, but they did not reach a level of significance (p 5 .6). Soferman et al, Interleukin-12 Peripheral Blood Levels in Asthmatic Children 131 ORIGINAL ARTICLE Interleukin-12 ... exposure early in life may protect against allergen sensitization. 23 Inhaled endotoxins trigger macro- phages and other myeloid cells, including myeloid DCs, through CD14, a LPS...
Ngày tải lên : 08/08/2014, 21:20
  • 6
  • 230
  • 0
Báo cáo y học: "Circulating tumour necrosis factor-α bioactivity in rheumatoid arthritis patients treated with infliximab: link to clinical respone" pot

Báo cáo y học: "Circulating tumour necrosis factor-α bioactivity in rheumatoid arthritis patients treated with infliximab: link to clinical respone" pot

... article Circulating tumour necrosis factor-α bioactivity in rheumatoid arthritis patients treated with infliximab: link to clinical response Hubert Marotte 1 , Wlodzimierz Maslinski 2 and Pierre ... by cytokines in mediating cell–cell interactions in rheumatoid synovium has led to the rational development of treatment with anticytokine agents. Among thes...
Ngày tải lên : 09/08/2014, 06:22
  • 7
  • 453
  • 0
Báo cáo y học: " A promoter haplotype of the interleukin-18 gene is associated with juvenile idiopathic arthritis in the Japanese population" pps

Báo cáo y học: " A promoter haplotype of the interleukin-18 gene is associated with juvenile idiopathic arthritis in the Japanese population" pps

... GAAAGTTTTAACACTGGAAACTGCAA SNP9 allele1 VIC-TTTTGGTAGCCCTCTC-MGB SNP9R TTACACTTTCTGCAACAGAAAGTAAGC SNP9 allele2 FAM-TTTTGGTATCCCTCTCC-MGB SNP11F ACAGGTTTTGGAAGGCACAGA SNP11 VIC- ACGGAAGAAAAGATTT-MGB SNP11R ... FAM-CACTTATCTGTAGAGCTT-MGB SNP4F CTGGCAATTCTGCCTTGTTTCAG SNP4 allele1VIC- CCGAAGATAAAAGAATC-MGB SNP4R GGATTACAGCCGTGAGCCA SNP4 allele2 FAM- CGAAGATAGAAGAATC-MGB SNP5F AAGCTGAGGCAGGAAGAT...
Ngày tải lên : 09/08/2014, 07:20
  • 9
  • 559
  • 0
Báo cáo y học: " A high serum level of eotaxin (CCL 11) is associated with less radiographic progression in early rheumatoid arthritis patients" doc

Báo cáo y học: " A high serum level of eotaxin (CCL 11) is associated with less radiographic progression in early rheumatoid arthritis patients" doc

... http:/ /arthritis- research.com/content/10/2/R28 Page 1 of 4 (page number not for citation purposes) Vol 10 No 2 Research article A high serum level of eotaxin (CCL 11) is associated with less radiographic progression in early rheumatoid arthritis ... showed any association to radiographic progression. Conclusion This study raises the hypothesis tha...
Ngày tải lên : 09/08/2014, 10:23
  • 4
  • 322
  • 0
Báo cáo khoa hoc:" Role of metabolically active hormones in the insulin resistance associated with short-term glucocorticoid treatment" doc

Báo cáo khoa hoc:" Role of metabolically active hormones in the insulin resistance associated with short-term glucocorticoid treatment" doc

... of 5 (page number not for citation purposes) Journal of Negative Results in BioMedicine Open Access Brief report Role of metabolically active hormones in the insulin resistance associated with ... CA). Insulin sensitivity was assessed using the homeostatic model (HOMA-S), which is directly related to fasting insulin and glucose levels [13]. A weighted combin...
Ngày tải lên : 11/08/2014, 08:20
  • 5
  • 304
  • 0
Báo cáo y học: " Upregulation of pirin expression by chronic cigarette smoking is associated with bronchial epithelial cell apoptosis" ppsx

Báo cáo y học: " Upregulation of pirin expression by chronic cigarette smoking is associated with bronchial epithelial cell apoptosis" ppsx

... using gene expression anal- ysis of the airway epithelium of smokers. Apoptosis of airway epithelial cells is relevant to the pathogenesis of chronic bronchitis because disruption of epithelial ... levels by infection with AdPirinFigure 4 Apoptosis in BEAS-2B bronchial epithelial cells following up-regulation of pirin levels by infection with AdPirin. BEAS-...
Ngày tải lên : 12/08/2014, 15:20
  • 13
  • 246
  • 0
Báo cáo y học: "Clinical review: Extracorporeal blood purification in severe sepsis" pdf

Báo cáo y học: "Clinical review: Extracorporeal blood purification in severe sepsis" pdf

... al. dilution). In arteriovenous circuits blood is driven by the patient’s blood pressure through a filter, via an extracorporeal circuit originating from an artery and terminating in a vein. However, in ... for blood purification, but are currently in the clinical testing phase. One such system is the molecular adsorbent regener- ating system device, which employs a polysulfo...
Ngày tải lên : 12/08/2014, 19:22
  • 7
  • 423
  • 0
Báo cáo y học: "A ball valve blood clot in the airways – life-saving whole tube suction" pps

Báo cáo y học: "A ball valve blood clot in the airways – life-saving whole tube suction" pps

... occlusion of the tube, acting as a ball valve obstructing the tube during expiration. Again we attempted to remove the clot by suctioning the airways, either using the catheter or by bronchoscopy, but ... as a one-way valve, allowing (near) normal air entry into the airways, but (completely) blocking expiration. In a near fatal case of obstruction of the airways...
Ngày tải lên : 12/08/2014, 20:20
  • 2
  • 240
  • 0
Báo cáo y học: "Bench-to-bedside review: Resuscitation in the emergency department" ppsx

Báo cáo y học: "Bench-to-bedside review: Resuscitation in the emergency department" ppsx

... augmenting systemic oxygen delivery [32]. The type and volume of infused fluid can influence vascular endothelial integrity and capillary permeability [33]. Intra-abdominal compartment syndrome, intracranial ... endeavor. The physician responsible for initiating resuscitation or life-sustaining therapy must fulfill that task [50]. Life-sustaining therapy that simply delays death and pro...
Ngày tải lên : 12/08/2014, 20:20
  • 7
  • 221
  • 0
Báo cáo y học: "The use of moderate hypothermia during cardiac surgery is associated with repression of tumour necrosis factor-α via inhibition of activating protein-1: an experimental study" doc

Báo cáo y học: "The use of moderate hypothermia during cardiac surgery is associated with repression of tumour necrosis factor-α via inhibition of activating protein-1: an experimental study" doc

... http://ccforum.com/content/10/2/R57 Page 1 of 9 (page number not for citation purposes) Vol 10 No 2 Research The use of moderate hypothermia during cardiac surgery is associated with repression of tumour necrosis factor-α via inhibition ... stimulated by TNF-α 10 ng/ml for 4 hours. Statistical analysis Results are expressed as mean ± standard deviation. Dat...
Ngày tải lên : 12/08/2014, 23:23
  • 9
  • 189
  • 0
Báo cáo y học: "Norepinephrine to increase blood pressure in endotoxaemic pigs is associated with improved hepatic mitochondrial respiration" doc

Báo cáo y học: "Norepinephrine to increase blood pressure in endotoxaemic pigs is associated with improved hepatic mitochondrial respiration" doc

... function during sepsis independent of its regional haemodynamic effects. This is in contrast to our findings in septic pigs, in which norepine- phrine was associated with an increase in the hepatic ... an increase in mitochondrial oxygen con- sumption associated with the increase in calcium concentra- tions may be related to an increase in mitochondri...
Ngày tải lên : 13/08/2014, 11:22
  • 10
  • 288
  • 0
Báo cáo y học: "Early drotrecogin alpha (activated) administration in severe sepsis is associated with lower mortality: a retrospective analysis of the Canadian ENHANCE cohort" ppsx

Báo cáo y học: "Early drotrecogin alpha (activated) administration in severe sepsis is associated with lower mortality: a retrospective analysis of the Canadian ENHANCE cohort" ppsx

... drotrecogin alpha (activated) administration in severe sepsis is associated with lower mortality: a retrospective analysis of the Canadian ENHANCE cohort Richard V Hodder 1 , Richard Hall 2 , James ... However, delays in initiating treatment with DrotAA in Canada are com- mon – in a registry of 4087 Canadian intensive care patients (1269...
Ngày tải lên : 13/08/2014, 16:20
  • 10
  • 309
  • 0
Báo cáo y học: "Bench-to-bedside review: Delirium in ICU patients - importance of sleep deprivation" doc

Báo cáo y học: "Bench-to-bedside review: Delirium in ICU patients - importance of sleep deprivation" doc

... Kribbs NB: Performing while sleepy: effects of experimentally-induced sleepiness. In Sleep, Sleepiness and Performance. Edited by Monk TH. New York: J Wiley; 1991:9 7- 128. 13. Harrison Y, Horne JA: ... with 3,4-dihydroxy- L-phenylalanine and opiates, cocaine binges, and hypoxia [40]. Activation of the dopaminergic system is also observed after periods of sleep deprivation [41]...
Ngày tải lên : 13/08/2014, 19:20
  • 8
  • 242
  • 0
Báo cáo y học: "Association of arterial blood pressure and vasopressor load with septic shock mortality: a post hoc analysis of a multicenter trial" potx

Báo cáo y học: "Association of arterial blood pressure and vasopressor load with septic shock mortality: a post hoc analysis of a multicenter trial" potx

... an increased risk of disease-related events and mortality in septic shock patients. Materials and methods The present study is a post hoc analysis of data of an interna- tional, multicenter, randomized, ... heart rate during septic shock and 28-day mortality. The figure presents the vasopressor load in study patients with a mean arterial blood pres...
Ngày tải lên : 13/08/2014, 19:20
  • 7
  • 289
  • 0

Xem thêm

Từ khóa: