Báo cáo y học: " Measuring the time costs of exercise: a proposed measuring method and a pilot study" doc
Báo cáo y học: " Measuring the time costs of exercise: a proposed measuring method and a pilot study" doc
... may
be low and is rarely a motivator of the activity. Hence, the
utility in use of the activity forgone in the investigation
may represent the marginal value of leisure time.
The yardstick method ... investigation, performed the statistical analysis, and
drafted and revised the manuscript. LAH and LL together developed the
model and questionnaire, and...
Báo cáo Y học: Monitoring the structural consequences of Phe12 fi D-Phe and Leu15 fi Aib substitution in human/rat corticotropin releasing hormone Implications for design of CRH antagonists pdf
... summary of statistical data indica-
ting the quality of the 40 models and the average energy-
minimized structure.
The polypeptide chain of the human/rat CRH analogue
seems to fold to an almost ... information towards
the design and synthesis of new molecules with higher
binding affinity and enhanced stability against biological
degradation and possibly biological a...
Báo cáo Y học: Reconstructing the replication complex of AcMNPV pdf
... CATCACAGATCTATGATTGA GGCCCGGGGAATTCATGATT
CAACATTTTAC GACAACATTTTA
HEL 3¢ CCGCCCGGGTTAACATACA GGCCCGGGCTCGAGCATAC
AAATTTGGTACAC AAAATTTGGTACAC
DNApol 5¢ CATCACAGATCTATGAAAAT GGCCCGGGGAATTCATGAA
ATATCC AATATATCC
DNApol ... GGCCCGGGCTCGAGTCGCC
TCCCATTGTTAAT AACTCCCATTGTTAAT
IE2 5¢ CATCACAGATCTATGAGTCG GGCCCGGGAATTCAGTCGC
CCAAATCAAC CAAATCAAC
IE2 3¢ CCGCCCGGGTTAACGTCTAG GGCCCGGGCTCGAGACGTC
ACATA...
Báo cáo Y học: Optimizing the delivery systems of chimeric RNA . DNA oligonucleotides Beyond general oligonucleotide transfer ppt
... reproducible
substances, with a hydrocarbon core and charged surface of
amino groups. They have the advantage of having a defined
small size. However, their efficiency and toxicity still need
evaluation.
Nanoparticles ... (dioleoylphosphatidylethanolamine) has the
ability to form nonbilayer phases and promote destabiliza-
tion of the bilayer of the endosome membrane. D...
Báo cáo y học: "Do the pleiotropic effects of statins in the vasculature predict a role in inflammatory diseases" pdf
... statins are
currently available within the UK: pravastatin, simvastatin,
fluvastatin, atorvastatin and rosuvastatin; in addition,
lovastatin is available in other countries. Cerivastatin has
been ... in
middle-aged male patients with a moderate degree of
hyperlipidaemia but no prior personal history of
cardiovascular disease. The value of statin therapy in
patients with known co...
Báo cáo y học: "Defining the chromatin signature of inducible genes in T cells" pps
... H3K9ac and H3 antibodies and Affymetrix
mouse promoter arrays (1.0R) and the data were analyzed
using the model-based analysis of tiling array (MAT) algo-
rithm [30]. The promoter region of a gene ... human data set contains information about a number of
other acetylation marks and we found that the majority of the
acetylation marks showed a similar pattern to...
Báo cáo y học: " Unraveling the genomic diversity of small eukaryotes" potx
... the plant
family Brassicaceae, while a third has made a host jump
across plant families and is a parasite of members of the
family Resedaceae.
The sequences of metagenomes - the total DNA of ... and Inaki Ruiz-Trillo
(University of Barcelona, Spain) highlighted studies on the
evolutionary significance of the Choano flagellata, the
Nuclearia and the...
Báo cáo y học: "Elucidating the molecular characteristics of organogenesis in human embryos" potx
... experi-
mental models but humans are the targets of potential
diagnostic and therapeutic approaches. Although
humans and mice share 85% of their genes and undergo a
similar process of embryogenesis, ... of this work is that it will enable
direct comparisons of available mammalian transcrip-
tomes. is type of comparative analysis is highly rele-
vant, considering tha...
Báo cáo y học: "Investigating the complementary value of discrete choice experiments for the evaluation of barriers and facilitators in implementation research: a questionnaire survey" pptx
... DCE and the traditional ques-
tions that might challenge the comparability of the
results. First, DCE is based on random utility theory that
assumes that an individual acts rationally and always
chooses ... care
professionals when they think of breast cancer surgery in
day care. Also, the cooperation of the ward nursing staff
and management was considered highly importan...
Báo cáo y học: "Can the collective intentions of individual professionals within healthcare teams predict the team''''s performance: developing methods and theory" docx
... the uptake of research findings, and
hence to reduce inappropriate care – using theory-based
approaches to understanding the behaviours of healthcare
professionals and the quality of care that ... northeast England, and primary care doc-
tors, nurses, and practice assistants in the Netherlands. We
regarded all the healthcare workers within a practice as a
team. D...
Từ khóa: