Báo cáo y học: " Measuring the time costs of exercise: a proposed measuring method and a pilot study" doc
... may be low and is rarely a motivator of the activity. Hence, the utility in use of the activity forgone in the investigation may represent the marginal value of leisure time. The yardstick method ... investigation, performed the statistical analysis, and drafted and revised the manuscript. LAH and LL together developed the model and questionnaire, and...
Ngày tải lên: 13/08/2014, 11:22
... summary of statistical data indica- ting the quality of the 40 models and the average energy- minimized structure. The polypeptide chain of the human/rat CRH analogue seems to fold to an almost ... information towards the design and synthesis of new molecules with higher binding affinity and enhanced stability against biological degradation and possibly biological a...
Ngày tải lên: 17/03/2014, 10:20
... CATCACAGATCTATGATTGA GGCCCGGGGAATTCATGATT CAACATTTTAC GACAACATTTTA HEL 3¢ CCGCCCGGGTTAACATACA GGCCCGGGCTCGAGCATAC AAATTTGGTACAC AAAATTTGGTACAC DNApol 5¢ CATCACAGATCTATGAAAAT GGCCCGGGGAATTCATGAA ATATCC AATATATCC DNApol ... GGCCCGGGCTCGAGTCGCC TCCCATTGTTAAT AACTCCCATTGTTAAT IE2 5¢ CATCACAGATCTATGAGTCG GGCCCGGGAATTCAGTCGC CCAAATCAAC CAAATCAAC IE2 3¢ CCGCCCGGGTTAACGTCTAG GGCCCGGGCTCGAGACGTC ACATA...
Ngày tải lên: 23/03/2014, 21:20
Báo cáo Y học: Optimizing the delivery systems of chimeric RNA . DNA oligonucleotides Beyond general oligonucleotide transfer ppt
... reproducible substances, with a hydrocarbon core and charged surface of amino groups. They have the advantage of having a defined small size. However, their efficiency and toxicity still need evaluation. Nanoparticles ... (dioleoylphosphatidylethanolamine) has the ability to form nonbilayer phases and promote destabiliza- tion of the bilayer of the endosome membrane. D...
Ngày tải lên: 31/03/2014, 08:20
Báo cáo y học: "Do the pleiotropic effects of statins in the vasculature predict a role in inflammatory diseases" pdf
... statins are currently available within the UK: pravastatin, simvastatin, fluvastatin, atorvastatin and rosuvastatin; in addition, lovastatin is available in other countries. Cerivastatin has been ... in middle-aged male patients with a moderate degree of hyperlipidaemia but no prior personal history of cardiovascular disease. The value of statin therapy in patients with known co...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "Defining the chromatin signature of inducible genes in T cells" pps
... H3K9ac and H3 antibodies and Affymetrix mouse promoter arrays (1.0R) and the data were analyzed using the model-based analysis of tiling array (MAT) algo- rithm [30]. The promoter region of a gene ... human data set contains information about a number of other acetylation marks and we found that the majority of the acetylation marks showed a similar pattern to...
Ngày tải lên: 09/08/2014, 20:20
Báo cáo y học: " Unraveling the genomic diversity of small eukaryotes" potx
... the plant family Brassicaceae, while a third has made a host jump across plant families and is a parasite of members of the family Resedaceae. The sequences of metagenomes - the total DNA of ... and Inaki Ruiz-Trillo (University of Barcelona, Spain) highlighted studies on the evolutionary significance of the Choano flagellata, the Nuclearia and the...
Ngày tải lên: 09/08/2014, 20:21
Báo cáo y học: "Elucidating the molecular characteristics of organogenesis in human embryos" potx
... experi- mental models but humans are the targets of potential diagnostic and therapeutic approaches. Although humans and mice share 85% of their genes and undergo a similar process of embryogenesis, ... of this work is that it will enable direct comparisons of available mammalian transcrip- tomes. is type of comparative analysis is highly rele- vant, considering tha...
Ngày tải lên: 09/08/2014, 20:22
Báo cáo y học: "Investigating the complementary value of discrete choice experiments for the evaluation of barriers and facilitators in implementation research: a questionnaire survey" pptx
... DCE and the traditional ques- tions that might challenge the comparability of the results. First, DCE is based on random utility theory that assumes that an individual acts rationally and always chooses ... care professionals when they think of breast cancer surgery in day care. Also, the cooperation of the ward nursing staff and management was considered highly importan...
Ngày tải lên: 11/08/2014, 05:21
Báo cáo y học: "Can the collective intentions of individual professionals within healthcare teams predict the team''''s performance: developing methods and theory" docx
... the uptake of research findings, and hence to reduce inappropriate care – using theory-based approaches to understanding the behaviours of healthcare professionals and the quality of care that ... northeast England, and primary care doc- tors, nurses, and practice assistants in the Netherlands. We regarded all the healthcare workers within a practice as a team. D...
Ngày tải lên: 11/08/2014, 05:21