Bóa cáo y học: "Is the value of a life or life-year saved context specific? Further evidence from a discrete choice experiment" ppt
... Abstract Background: A number of recent findings imply that the value of a life saved, life- year (LY) saved or quality-adjusted life year (QALY) saved varies depending on the characteristics of the life, ... rejection of, simple health maximisation that is required. Introduction A number of recent findings imply that the value of a life saved,...
Ngày tải lên: 13/08/2014, 11:22
... taken together form a Voronoi diagram of a country's land area with each laboratory at the center of a specific Voronoi cell [34]. Within each laboratory area, the driving path for lab- oratory ... transport is assumed to originate at the laboratory, travel away from the center until it reaches a distance of half the radius of the lab area, follow a circle...
Ngày tải lên: 13/08/2014, 11:22
... variables for uniform reporting of data from advanced airway management in the field Data variable name Data variable categories or values Definition of data variable System variables Highest level of ... reported variable was Table 2 Fixed system variables for uniform reporting of data from advanced airway management in the field, identified by an international expert group...
Ngày tải lên: 14/08/2014, 07:21
Báo cáo y học: " Disrupting the rhythm of depression using Mobile Cognitive Therapy for recurrent depression: randomized controlled trial design and protocol" ppt
... term, and as a cost-utility ana- lysis with incremental costs per quality adjusted life years (QALYs) gained as the clinical endpoint. For the latter, health-related quality of life, will be assessed with ... for the other variables, including baseline values of the dependent variable as a covariate in all analyses. We shall use implicit and explicit cognitive measures and...
Ngày tải lên: 11/08/2014, 16:23
Báo cáo y học: "Drawing the tree of eukaryotic life based on the analysis of 2,269 manually annotated myosins from 328 species" ppsx
... Distance Md Bt Caf Mam Rn Hs Pat Mm 0 3.6 (distant) (close) No Data Myo 1A Myo1B Myo1C Myo1D Myo1E Myo1F Myo1G Myo1H Myo 3A Myo3B Myo 5A Myo5B Myo5C Myo6 Myo 7A Myo7B Myo 9A Myo9B Myo10 Myo15 Myo16 Myo1 8A Myo18B Myo19 Myo35 times mean distance within class ... have been reanalyzed as soon as data from closely related organisms or further species specific data (new cDNA/EST data...
Ngày tải lên: 14/08/2014, 08:20
Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot
... R/ Bioconductor and the lumi pa ckage [22]. Based on the quality assessment, all 38 samples were deemed suitable for further analysis. Data normalization was performed using a variance-stabilising transform ... subunit D ATP6V1DL ttttcactagctgaagccaagtt ATP6V1DR gcgctttattgacattttggat VIRvsLTNP CD8 2.0 2.8 BAG3 NM_004281.3 BCL2-associated athanogene 3 BAG3L cagccagataaacagtgtggac BAG3...
Ngày tải lên: 13/08/2014, 01:20
Bóa cáo y học: " Identification and characterisation of the high-risk surgical population in the United Kingdom" pps
... analysis and drafting the man- uscript, and approved the final version. All authors had full access to data and take responsibility for the integrity of the data and the accuracy of the analysis. References 1. ... identified from the CHKS and ICNARC databasesMortality rates for general surgical patients identified from the CHKS and ICNARC databases. CHKS database: sta...
Ngày tải lên: 12/08/2014, 23:23
Báo cáo y học: " Is reducing variability of blood glucose the real but hidden target of intensive insulin therapy" pot
... kinase C and nuclear factor-kappa-B; and (d) increased hexosamine pathway flux [28,29]. Furthermore, Watada and colleagues [30] and Azuma and colleagues [31] have shown that large glycemic variability ... glycemia as markers of glycemic variability. We found that such variability was independently associated with ICU and hospital mortality rates as well as length of ICU stay. Most importa...
Ngày tải lên: 13/08/2014, 16:20
Báo cáo y học: "Demonstrating the benefit of medical emergency teams (MET) proves more difficult than anticipated"
... primary endpoint. Unfortunately, the incidence rate for the primary outcome was much smaller than anticipated while inter-hospital variability and intra-class correlation were much larger than ... Qual Saf Health Care 2004, 13:251-254. 6. Nathens AB, Jurkovich GJ, Cummings P, Rivara FP, Maier RV: The effect of organized systems of trauma care on motor vehicle crash mortality...
Ngày tải lên: 25/10/2012, 10:39
Tài liệu Báo cáo khoa học: "Is the End of Supervised Parsing in Sight?" pdf
... Language Resources and Evaluation (LREC). Zollmann, A. and K. Sima'an 2005. A consistent and efficient estimator for data-oriented parsing. Journal of Automata, Languages and Combinatorics, ... indicates that U-DOP*’s grammar is still of manageable size even for text corpora that are (almost) two orders of magnitude larger than Penn’s WSJ. The NANC corpus contains approx...
Ngày tải lên: 20/02/2014, 12:20