0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Bóa cáo y học: "Is the value of a life or life-year saved context specific? Further evidence from a discrete choice experiment" ppt

Bóa cáo y học:

Bóa cáo y học: "Is the value of a life or life-year saved context specific? Further evidence from a discrete choice experiment" ppt

... AbstractBackground: A number of recent findings imply that the value of a life saved, life- year (LY) saved or quality-adjusted life year (QALY) saved varies depending on the characteristics of the life, ... rejection of, simple health maximisation that is required.Introduction A number of recent findings imply that the value of a life saved, life- year (LY) saved or quality-adjusted life year(QALY) saved ... subjectiveand actuarial estimates of life- expectancy in a sample of 2037 Americans aged 18–95. Specifically, males typicallyevaluated their life- expectancy at approximately 3 yearslonger than was...
  • 15
  • 363
  • 0
Bóa cáo y học:

Bóa cáo y học: "Estimating the cost of cervical cancer screening in five developing countries" docx

... takentogether form a Voronoi diagram of a country's land areawith each laboratory at the center of a specific Voronoi cell[34]. Within each laboratory area, the driving path for lab-oratory ... transport is assumed to originate at the laboratory,travel away from the center until it reaches a distance of half the radius of the lab area, follow a circle of half the radius of the lab area ... particular capacity level,we then determined the size of the area serviced by the lab:Each laboratory is assumed to serve all eligible individualswithin a laboratory area. All laboratory areas takentogether...
  • 17
  • 335
  • 0
Báo cáo y học:

Báo cáo y học: "Revisiting the value of pre-hospital tracheal intubation: an all time systematic literature review extracting the Utstein airway core variables" pptx

... variables for uniform reporting of data from advanced airway management in the fieldData variable name Data variable categories or valuesDefinition of data variableSystem variablesHighest level of ... reported variable wasTable 2 Fixed system variables for uniform reporting of data from advanced airway management in the field,identified by an international expert groupData variable name Data ... Data variable categories or valuesDefinition of data variablePopulation Number Population count in the primary response area of the EMSArea Number Area in square km or square miles of primary...
  • 11
  • 299
  • 0
Báo cáo y học:

Báo cáo y học: " Disrupting the rhythm of depression using Mobile Cognitive Therapy for recurrent depression: randomized controlled trial design and protocol" ppt

... term, and as a cost-utility ana-lysis with incremental costs per quality adjusted life years (QALYs) gained as the clinical endpoint. For the latter, health-related quality of life, will be assessedwith ... for the other variables, including baseline values of the dependent variable as a covariate in all analyses. Weshall use implicit and explicit cognitive measures andstress measures (daily hassles) ... of Clinical Psychology of the Vrije Universiteit, Amsterdam, The Netherlands.8Mental Health Care Center Arkin/PuntP, Amsterdam, The Netherlands.9Department of Psychiatry, University of Pennsylvania,...
  • 9
  • 234
  • 0
Báo cáo y học:

Báo cáo y học: "Drawing the tree of eukaryotic life based on the analysis of 2,269 manually annotated myosins from 328 species" ppsx

... DistanceMdBtCafMamRnHsPatMm03.6(distant)(close)No DataMyo 1A Myo1BMyo1CMyo1DMyo1EMyo1FMyo1GMyo1HMyo 3A Myo3BMyo 5A Myo5BMyo5CMyo6Myo 7A Myo7BMyo 9A Myo9BMyo10Myo15Myo16Myo1 8A Myo18BMyo19Myo35times mean distancewithin class ... have been reanalyzed as soon as data from closely related organisms or further species specific data(new cDNA/EST data or a new assembly version) becameavailable. In addition to manually annotating ... neoformans var. neoformans JEC21; Fnd_b, Filobasidiella neoformans var. neoformans B-350 1A; Fna_b, Filobasidiella neoformans var. neoformans H99; Fnb_b, Filobasidiella neoformans var. bacillispora...
  • 23
  • 354
  • 0
Báo cáo y học:

Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot

... R/Bioconductor and the lumi pa ckage [22]. Based on the quality assessment, all 38 samples were deemed suitablefor further analysis. Data normalization was performedusing a variance-stabilising transform ... subunit D ATP6V1DL ttttcactagctgaagccaagtt ATP6V1DR gcgctttattgacattttggat VIRvsLTNP CD8 2.0 2.8BAG3 NM_004281.3 BCL2-associated athanogene 3 BAG3L cagccagataaacagtgtggac BAG3R agaggcagctggagactgg ... dry and scanned on the Illumina BeadArray Readerconfocal scanner.Analysis of differentially expressed genes The quality of the entire da ta set w as assessed by boxplot and density plot of...
  • 21
  • 376
  • 0
Bóa cáo y học:

Bóa cáo y học: " Identification and characterisation of the high-risk surgical population in the United Kingdom" pps

... analysis and drafting the man-uscript, and approved the final version. All authors had fullaccess to data and take responsibility for the integrity of the data and the accuracy of the analysis.References1. ... identified from the CHKS and ICNARC databasesMortality rates for general surgical patients identified from the CHKS and ICNARC databases. CHKS database: standard, all patients admitted to hospital for ... postopera-tive care on a standard ward.Figure 2Duration of hospital stay for general surgical patients identified from the CHKS and ICNARC databasesDuration of hospital stay for general surgical patients...
  • 6
  • 236
  • 0

... kinase C and nuclear factor-kappa-B; and (d)increased hexosamine pathway flux [28,29]. Furthermore,Watada and colleagues [30] and Azuma and colleagues [31]have shown that large glycemic variability ... glycemia as markers of glycemicvariability. We found that such variability was independentlyassociated with ICU and hospital mortality rates as well aslength of ICU stay. Most importantly, ... glucose sensors and was used asan assessment tool for inter-day variability. Thus, it is also notsuitable for the assessment of intra-day glycemic variability.Only one study has compared the predictive...
  • 5
  • 315
  • 0
Báo cáo y học:

Báo cáo y học: "Demonstrating the benefit of medical emergency teams (MET) proves more difficult than anticipated"

... primary endpoint. Unfortunately, the incidence rate for the primary outcome was much smaller than anticipated while inter-hospital variability and intra-class correlation were much larger than ... Qual Saf Health Care 2004, 13:251-254. 6. Nathens AB, Jurkovich GJ, Cummings P, Rivara FP, Maier RV: The effect of organized systems of trauma care on motor vehicle crash mortality. JAMA ... Moore GE, Bernard SA, Waxman BP, Anderson JN, Nguyen TV: Effects of a medical emergency team on reduction of incidence of and mortality from unexpected cardiac arrests in hospital: preliminary...
  • 2
  • 384
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Is the End of Supervised Parsing in Sight?" pdf

... Language Resources and Evaluation (LREC). Zollmann, A. and K. Sima'an 2005. A consistent and efficient estimator for data-oriented parsing. Journal of Automata, Languages and Combinatorics, ... indicates that U-DOP*’s grammar is still of manageable size even for text corpora that are (almost) two orders of magnitude larger than Penn’s WSJ. The NANC corpus contains approximately 2 ... 2004, Geneva. Hearne, M and A. Way, 2006. Disambiguation Strategies for Data-Oriented Translation. Proceedings of the 11th Conference of the European Association for Machine Translation, Oslo....
  • 8
  • 525
  • 0

Xem thêm

Từ khóa: what is the value of a liquids vapor pressure at its normal boiling pointwhat is the value of a and b at end of this programwhat is the value of b at the end of this program requirement to use the least optimistic measures when the value of an asset or liability is uncertainthe maxscroll property refers to the maximum value of the scroll property this value is the value of scroll when the last line of text is visible in this example maxscroll 4lt if supportlists gt ·         trước một mệnh đề p hụ mà cấu trúc động từ ở thời bị động         this is the value of x which was obtained from the areas under the normal curvewhat is the structure of a network packetwhat is the definition of a rainforest biomewhat is the climate of a rainforest biomewhat is the climate of a temperate rainforest biomewhat is the climate of a tropical rainforest biomewhat is the structure of a capillary networkwhat is the structure of a html source filewhat is the purpose of a business having aims and objectiveswhat is the use of a distributed file systemBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ