Báo cáo khoa học: " Copeptin: a new and promising diagnostic and prognostic marker" pdf

... Morgen- thaler NG, Squire IB, Davies JE, Bergmann A, Ng LL: C-terminal provasopressin (copeptin) as a novel and prognostic marker in acute myocardial infarction: Leicester Acute Myocardial Infarction ... Mor- genthaler NG, Bergmann A, Haltmayer M, Mueller T: Compara- tive evaluation of B-type natriuretic peptide, mid-regional pro -A- type natriuretic peptide, mid-regional pro-adreno-...

Ngày tải lên: 13/08/2014, 10:20

... chromosome in Ralstonia eutropha, Azoarcus sp., Methylococcus capsulatus, Bordetella pertussis, Methylobacillus flagellatus, and Burkholderia cepacia, but the RNAse, protease, and GTPase remain clus- tered. ... purified apoprotein with trypsin (T) and Asp-N endo- proteinase (D), and of native protein with Glu-C endoproteinase (S). Amino acids identified by Edman degradation and MS tand...

Ngày tải lên: 08/03/2014, 08:20

... to grammatical agreement, also with verbs and adjectives in the above mentioned way, and because in tech- nical texts substantially more masculine- -animate than feminine-animate nouns are ... word-ending, ambiguous among nomi- native and accusative singular masculine- -inanimate, and nominative singular masculine-animate, thus representing the adjectival "normal form,&ap...

Ngày tải lên: 09/03/2014, 01:20

... JM, ePlazas PV, Watkins M, Gomez-Casati ME, Olivera BM & Elgoyhen AB (2005) A novel alpha- conotoxin, PeIA, cloned from Conus pergrandis, discriminates between rat alpha9alpha10 and alpha7 nicotinic ... Target SI ICCNPACGPKYSC a a 1 b 1 cd SIA YCCHPACGKNFDC a a 1 b 1 cd GI ECCNPACGRHYSC a a 1 b 1 cd GIA ECCNPACGRHYSCGK a a 1 b 1 cd GII ECCHPACGKHFSC a a 1 b 1 cd MI GRCCHPACG...

Ngày tải lên: 16/03/2014, 11:20

... Bovine TNF- α was amplified with F primer 5’-GAA GCT AGC ATG AGC ACC AAA AGC ATG ATC CGG-3’ and R primer 5’-GAA CTC GAG TCA CAG GGC GAT GAT CCC AAA GTA-5’. PCR mixture (100 µ l) contained 10 µ l ... FastTrack TM mRNA isolation kit (Invitrogen). A cDNA library was constructed according to manufacturer’s protocol using Gubler and Hoffman’s method. Double strand cDNA was fractionated o...

Ngày tải lên: 07/08/2014, 15:20

... 5¢-GGGAATTCCATATGAGAGACAATA TTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGT CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢ ,and PDE1(Lys321–Thr620) was amplified with primers 5¢-GGG AATTCCATATGAAGAATGATCAATCTGGCTGCG GCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGG TTCCCTGTCCAGTGTTACC-3¢. ... parasites as potential targets for antiparasitic drugs. The African trypanosome Trypanosoma brucei is the protozoon that causes the...

Ngày tải lên: 19/02/2014, 12:20

... Translating a Unification Grammar with Disjunctions into Logical Constraints Mikio Nakano and Akira Shimazu* NTT Basic Research Laboratories 3-1 Morinosato-Wakamiya, Atsugi 243-0198 Japan ... unification-based approach is that it enables us to describe grammar declaratively, making the development and amendment of grammar easy. Analysis systems that are based on unification gram-...

Ngày tải lên: 20/02/2014, 18:20

... distance. IEEE Transactions on Pattern Analysis and Machine Intelligence, 20(5):522–532. K. Tsuji. 2002. Automatic extraction of translational Japanese-katakana and English word pairs. Interna- tional ... bi- texts contain Arabic news articles and their English translations aligned at the sentence level, and both are available from the Linguistic Date Consortium. The Treebank data was...

Ngày tải lên: 08/03/2014, 02:21

... Briscoe, Ann Copes- take and Valeria de Paiva eds. Cambridge Uni- versity Press, Cambridge. Daelemans, Walter, Koenraad De Smedt and Ger- ald Gazdar. 1992. Inheritance in Natural Lan- guage Processing. ... Briscoe, Ann Copestake and Valeria de Paiva eds. Cambridge University Press, Cambridge. Lascarides, Alex, Ann Copestake and Ted Briscoe. 199 6a. Ambiguity and Coherence....

Ngày tải lên: 17/03/2014, 23:20

... The 414 complex variations of template instantiations in text. Finally, we note that our particular figures are specific to this dataset and the biological ab- stracts domain. However, the annotation and anal- ysis ... standard application dataset. It is also the first evaluation of a generic paraphrase-based approach for the stan- dard RE setting. Our findings are encouraging for both goal...

Ngày tải lên: 31/03/2014, 20:20