Báo cáo khoa học: "Comparison of different pain scoring systems in critically ill patients in a general ICU" pdf

... regime for analgesia and sedation, a trend is observed away from a hypnosis-based approach and toward an analgesia-based approach. Although these changes may improve pain and sedation practice, ... further efforts are needed for widespread implementation of pain scoring systems and analgesia protocols [8,9]. Of the availa- ble pain scales, the Numerical Rating Scale (NRS) (1...

Ngày tải lên: 13/08/2014, 10:20

... 136.5% of their esti- mated caloric requirements. The energy intake of the OF patients was more than 40 kcal/kg per day on average. Looking at the individual data, three AF patients and nine OF patients ... require- ments. AF was defined as a subject’s actual average energy intake being within ± 10% of total energy requirements. For OF, the actual average energy intake was...

Ngày tải lên: 12/08/2014, 19:22

... visits, length of stay, and hospital overcrowding have been associated with an increasing number of critically ill patients cared for in the ED. Existing physiologic scoring systems have traditionally ... adding end-tidal carbon dioxide capnometry to MEES has significantly greater value than MEES alone in predicting survival after cardiopulmonary resuscitation in nontrauma...

Ngày tải lên: 12/08/2014, 22:21

... Netherland DE, Dhillon R, Heath BJ. Air leaks after surgical stapling in lung resection: a comparison between stapling alone and stapling with staple-line re- inforcement materials in a canine model. ... pericardial grafts, pericardial fat pad grafts, diaphragm, azygous vein, pericardiophrenic pedicles, me- diastinum and transposition of extra-thoracic muscles (intercostal, serr...

Ngày tải lên: 07/08/2014, 20:23

... interpretation of the BIS is based on the assumption that sedation is intended to produce a state of sleep that includes a lack of awareness and a lack of recall, whereas analgesia is intended ... defined as a change in arterial pressure of more than 40% from baseline, bradycardia to less than 50 beats/min, or tachyarrhythmia. No other sedative or analgesic agents were giv...

Ngày tải lên: 12/08/2014, 19:22

... trial all ewes were inseminated. The ewes were inseminated vaginally with a dose of approximately 200 × 10 6 frozen-thawed spermato- zoa. The vaginal inseminations were made with an insem- ination ... Minitüb, Tiefenbach, Germany), and the remaining part was used for automatic filling (MRS 3, IMV, L'Aigle, France) of mini straws (0.25 ml, IMV, L'Aigle, France) resulting in...

Ngày tải lên: 12/08/2014, 18:22

... antibody (claudin-3 antibody; Abcam, Cambridge, MA, USA; SLC2 5A4 mAb, Abnova, Taipei, Taiwan; HLA Class 1 A1 antibody, Abcam; Tapasin antibody, Abcam) at a dilution of 1 : 1000 for 2 h, followed by incubation ... molecule activity (collagen I alpha-1 chain, collagen I alpha-2 chain, tubulin beta chain), molecular transducer activity (ITGB2, interferon- induced transmembrane protein 1,...

Ngày tải lên: 16/02/2014, 15:20

... GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC cyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG cyc1-z GCATCAGAAAGCATAGGC cyc1-m TGGGAATACGATAGAGTAG nb2 primer GTTTAAACGAGCTCGAATTC Coq7 in fission yeast R. ... GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG Spcoq3-y GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG Spcoq3-z GTATGCGATGTGGAATTTG Spcoq3-m GATGCCTTCCAATGAATTAC cyc1-w GAACCAATGAAATAAGGGCG cyc1...

Ngày tải lên: 18/02/2014, 14:20

... 1) gave rise to a 10-fold increase in K m and a corresponding decrease in k cat ⁄ K m , underscoring the importance of the interactions between the Tyr OH and the side chains of Asn174 and Asp148 ... acceptable catalytic power using either of the approaches taken here. As observed for various other proteases including papain [15] and HIV protease [16], the intertwined network o...

Ngày tải lên: 19/02/2014, 16:20

... in Eagle’s minimal essential medium (ATCC, Manassas, VA) supplemented with 10% heat-inactivated fetal bovine serum in an atmo- sphere of 5% CO 2 at 37 °C. A quantitative adherence assay was performed ... The data represent the average of three independent assays. Nasopharyngeal clearance pattern in animal model Female BALB ⁄ c mice (6–8 weeks of age) were obtained from Taconic F...

Ngày tải lên: 07/03/2014, 05:20