Báo cáo khoa học: "opeptin, a novel prognostic biomarker in ventilator-associated pneumonia" ppsx

Báo cáo khoa học: "opeptin, a novel prognostic biomarker in ventilator-associated pneumonia" ppsx

Báo cáo khoa học: "opeptin, a novel prognostic biomarker in ventilator-associated pneumonia" ppsx

... pneumonia patients on day 4: univariable and multivariable logistic regression analysis Parameter Univariable analysis Multivariable analysis Odds ratio (95% confidence interval) P value Odds ratio ... prediction in ventilator-associated pneumonia patientsReceiver operating characteristic analysis of copeptin with respect to mortality prediction in ventilator-associated pneumonia pa...

Ngày tải lên: 13/08/2014, 10:20

9 252 0
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

... antisense AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts ... Journal compilation ª 2009 FEBS TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses Kristiina A. Vuori 1 ,...

Ngày tải lên: 18/02/2014, 14:20

9 457 0
Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

... 5¢-GGGAATTCCATATGAGAGACAATA TTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGT CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,and PDE1(Lys321–Thr620) was amplified with primers 5¢-GGG AATTCCATATGAAGAATGATCAATCTGGCTGCG GCGCAC-3¢ ... causes the fatal human sleeping sickness, as well as Nagana, a devastating disease of domestic animals in large parts of sub-Saharan Africa. While many aspects of trypanosome cell biolo...

Ngày tải lên: 19/02/2014, 12:20

11 566 0
Báo cáo khoa học: Phaiodotoxin, a novel structural class of insect-toxin isolated from the venom of the Mexican scorpion Anuroctonus phaiodactylus pdf

Báo cáo khoa học: Phaiodotoxin, a novel structural class of insect-toxin isolated from the venom of the Mexican scorpion Anuroctonus phaiodactylus pdf

... and mammalian Na + channels. Accordingly, they are divided into classical a- toxins that are highly active in mammalian brain, a- toxins that are very active in insects and a- like toxins that are active ... phaiodotoxin The amino acid sequence o f the N-terminal portion of phaiodotoxin was obtained by Edman degradation carried out with an automatic apparatus Beckman LF 3000 Pro- tein...

Ngày tải lên: 07/03/2014, 16:20

9 534 0
Báo cáo khoa học: Brox, a novel farnesylated Bro1 domain-containing protein that associates with charged multivesicular body protein 4 (CHMP4) potx

Báo cáo khoa học: Brox, a novel farnesylated Bro1 domain-containing protein that associates with charged multivesicular body protein 4 (CHMP4) potx

... Bro1 domain-containing protein with a thioester-linkage site of isoprenoid lipid (CAAX motif, C standing for cys- teine, A for generally aliphatic amino acid, and X for any amino acid)] in this article, ... University, Japan Alix (also named AIP1) is an interacting partner of the penta-EF-hand Ca 2+ -binding protein, ALG-2 [1–5], and acts as a multifunctional adaptor protein in vari...

Ngày tải lên: 16/03/2014, 06:20

11 412 0
Báo cáo khoa học: Plasmoredoxin, a novel redox-active protein unique for malarial parasites doc

Báo cáo khoa học: Plasmoredoxin, a novel redox-active protein unique for malarial parasites doc

... Kawazu, S., Tsuji, N., Hatabu, T., Kawai, S., Matsumoto, Y. & Kano, S. (2000) Molecular cloning and characterization of a peroxiredoxin from the human malaria parasite Plasmodium fal- ciparum. ... tertian malaria in man. Interestingly, two similar sequence annotations (Gen- Bank accesson numbers, NP_473166 and CAB38989) were available that proposed a large protein of 2417 and 2396 a...

Ngày tải lên: 31/03/2014, 07:20

8 412 0
Báo cáo khóa học: Characterization of novel structural features in the lipopolysaccharide of nondisease associated nontypeable Haemophilus influenzae pptx

Báo cáo khóa học: Characterization of novel structural features in the lipopolysaccharide of nondisease associated nontypeable Haemophilus influenzae pptx

... structural data has been available on LPS glycoform patterns from H. in uenzae strains that were not associated with disease. Structural studies have revealed that every NTHi strain investigated ... HepIII. Additionally, both strains express glycine, and strain 11 also expresses detectable amounts of N-acetylneuraminic acid. Keywords: carriage; ESI-MS; Haemophilus in uenzae; lipopolysacchar...

Ngày tải lên: 16/03/2014, 16:20

13 411 0
Báo cáo khoa học: "Coexistence of carcinoma and tuberculosis in one breast" ppsx

Báo cáo khoa học: "Coexistence of carcinoma and tuberculosis in one breast" ppsx

... within the paratracheal, internal mammary, or axillary nodal basin [9]. Histologically, TM can be classified into nodular which mimics carcinoma; disseminated which causes caseation and sinus ... ultrasound with some cortical thickening at its distal pole suggesting focal metastasis. Infiltrating ductal carcinoma in the lower half of the field with two epithelioid granulomata containing .....

Ngày tải lên: 09/08/2014, 07:21

4 266 0
Báo cáo khoa học: The A domain of fibronectin-binding protein B of Staphylococcus aureus contains a novel fibronectin binding site pdf

Báo cáo khoa học: The A domain of fibronectin-binding protein B of Staphylococcus aureus contains a novel fibronectin binding site pdf

... ATTCCCGGGTAATTTTTCCAAGTTAAATTACTTG SmaI rFnBPB 163–308 F GGGGGATCCGGTACAGATGTAACAAATAAAG BamHI rFnBPB 163–308 R CTCCCCGGGCTATTGAATATTAAATATTTTGCTAA SmaI rFnBPB 309–480 F CCCGGATCCTATTTAGGTGGAGTTAGAGATAAT ... (5¢–3¢) a, b 5¢ restriction site rFnBPB 37–480 F CGGGGATCCGCATCGGAACAAAACAATAC BamHI rFnBPB 37–480 R AATCCCGGGTTACTTTAGTTTATCTTTGCCG SmaI rFnBPB 163–463 F GGGGGATCCGGTACAGATGTAACAAATAAAG...

Ngày tải lên: 06/03/2014, 00:20

13 515 0
Từ khóa:
w