Báo cáo khoa học: "Moisturizing body milk as a reservoir of Burkholderia cepacia: outbreak of nosocomial infection in a multidisciplinary intensive care unit" ppsx

Báo cáo khoa học: "Moisturizing body milk as a reservoir of Burkholderia cepacia: outbreak of nosocomial infection in a multidisciplinary intensive care unit" ppsx

Báo cáo khoa học: "Moisturizing body milk as a reservoir of Burkholderia cepacia: outbreak of nosocomial infection in a multidisciplinary intensive care unit" ppsx

... unit. Isolation of B. cepacia was associated with bacteraemia in three cases, lower respiratory tract infection in one and urinary tract infection in one. Contact isolation measures were instituted; ... infection in one and uri- nary tract infection in one. The cause of bacteraemia was attributed to a respiratory source in one case and to a central venous catheter...

Ngày tải lên: 13/08/2014, 10:20

6 348 0
Báo cáo khóa học: CD38 is expressed as noncovalently associated homodimers on the surface of murine B lymphocytes doc

Báo cáo khóa học: CD38 is expressed as noncovalently associated homodimers on the surface of murine B lymphocytes doc

... levels and at least five individual clones were picked to expand and analyze experimentally. Measurement of cyclase and glycohydrolase activity in Ba/F3 transfectant cell homogenates Transfected Ba/F3 ... replacement amino acid codons are indicated in lower case italics: CD38-E150L, primer 1: 5¢-(TACTT GGATCCAGGGAAAGATGTTCACCCTG ctGGACACCCTG)-3¢; CD38-E150L, primer 2: 5¢-(CC C TCTAGACCAG...

Ngày tải lên: 23/03/2014, 12:20

10 449 0
Báo cáo khoa học: "The stylomastoid artery as an anatomical landmark to the facial nerve during parotid surgery: a clinico-anatomic study" pptx

Báo cáo khoa học: "The stylomastoid artery as an anatomical landmark to the facial nerve during parotid surgery: a clinico-anatomic study" pptx

... histologically. Intraoperative clinico-anatomical data included: origin of the stylomastoid artery (SMA), recording the usual posi- tion and any variation of the facial nerve (FN) and assess- ing whether the stylomastoid ... incision and standard dissection was per- formed as described above. Clinical and gross anatomical photography was obtained from a Fujifilm Finepix 2 Meg- apixel...

Ngày tải lên: 09/08/2014, 04:21

5 312 0
Báo cáo khoa học: Aegyptin displays high-affinity for the von Willebrand factor binding site (RGQOGVMGF) in collagen and inhibits carotid thrombus formation in vivo ppt

Báo cáo khoa học: Aegyptin displays high-affinity for the von Willebrand factor binding site (RGQOGVMGF) in collagen and inhibits carotid thrombus formation in vivo ppt

... Tao L, Sun B, Kambay- ashi J, Watanabe H, Luo E & Matsuoka H (2008) Inhi- bition of collagen-induced platelet aggregation by anopheline antiplatelet protein, a saliva protein from a malaria ... and a global two-state reaction model was used to calculate the kinetic parame- ters. (C) Functional assay using human platelet-rich plasma shows that aegyptin is ineffective at inhibiting...

Ngày tải lên: 22/03/2014, 21:20

15 416 0
Báo cáo khoa học: Etoposide upregulates Bax-enhancing tumour necrosis factor-related apoptosis inducing ligand-mediated apoptosis in the human hepatocellular carcinoma cell line QGY-7703 pdf

Báo cáo khoa học: Etoposide upregulates Bax-enhancing tumour necrosis factor-related apoptosis inducing ligand-mediated apoptosis in the human hepatocellular carcinoma cell line QGY-7703 pdf

... independently of death receptors. In general, activation of the caspase cascade requires both initiator caspases such as caspase-8 and -9, and effector caspases, such as caspase-3 and -7 [55]. The death ... ligands and the chemotherapeutic agents are two distinct classes of signals used to induce apoptosis and activate the caspase cascade. Caspase-8 is known as the initiator casp...

Ngày tải lên: 23/03/2014, 17:22

11 409 0
Báo cáo khoa học: "Pulmonary intravascular lymphoma diagnosed by 18fluorodeoxyglucose positron emission tomography-guided transbronchial lung biopsy in a man with long-term survival: a case report" pot

Báo cáo khoa học: "Pulmonary intravascular lymphoma diagnosed by 18fluorodeoxyglucose positron emission tomography-guided transbronchial lung biopsy in a man with long-term survival: a case report" pot

... Takimoto T, Nakata S, Shiga J, Nagate Y, Nakagawa T, Take H, Katagiri S: Intravascular large B-cell lymphoma presenting pulmonary arterial hypertension as an initial manifestation. Intern Med 2010, ... involvement of intravascular lymphoma that presents no abnormality in a computed tomography scan. Case presentation: We report the case of a 61-year-old Japanese man who had pulmona...

Ngày tải lên: 10/08/2014, 23:21

6 181 0
Tài liệu Báo cáo khoa học: Peroxiredoxin II functions as a signal terminator for H2O2-activated phospholipase D1 doc

Tài liệu Báo cáo khoa học: Peroxiredoxin II functions as a signal terminator for H2O2-activated phospholipase D1 doc

... (PKC, ARF and RhoA) that stimulate it directly [14–18], interactions involving other proteins, such as actin, protein kinase N, casein-kinase-2-like serine kinase and amphiphysin, Keywords hydrogen ... Involve- ment of protein kinase C in the phosphorylation of 46 kDa proteins which are phosphorylated in parallel with activation of NADPH oxidase in intact guinea-pig poly- morpho...

Ngày tải lên: 20/02/2014, 01:20

9 402 0
Tài liệu Báo cáo khoa học: Stem–loop oligonucleotides as tools for labelling double-stranded DNA pdf

Tài liệu Báo cáo khoa học: Stem–loop oligonucleotides as tools for labelling double-stranded DNA pdf

... Sequence TC4 CGGTCCTATTTCGACGCTAGCTTTTTTTTCTCTTTCCTCCTTTTCTTTTCACGTGGAGCTTCTAGG TC6 CGGTCCTAGTTCGACGCTAGCTTTTTTTTCTCTTTCCTCCTTTTCTTTTCACGTGGAGCTACTAGG TC8 CGGTCCTAGTACTCGACGCTAGCTTTTTTTTCTCTTTCCTCCTTTTCTTTTCACGTGGAGCTGTACTAGG TC10 CGGTCCTAGTACGCTCGACGCTAGCAAAATTTTCTCTTTCCTCCTTTTCAAAACACGTGGAGCTGCGTACTAGG TG6 CGGTCCTAGTTCGACGCTAGCAAAAGTTTTGGTGGTTTGTGTTTTAAAACACGTGGAGCTACTAGG TG8 CGGTCCTAGTACTC...

Ngày tải lên: 20/02/2014, 03:20

10 371 0
Tài liệu Báo cáo khoa học: "Minimal Recursion Semantics as Dominance Constraints: Translation, Evaluation, and Analysis" pptx

Tài liệu Báo cáo khoa học: "Minimal Recursion Semantics as Dominance Constraints: Translation, Evaluation, and Analysis" pptx

... and e,x, y available e prop a x a y cafeteria x sauna y and e,x,y available e prop ϕ 1 ϕ 2 Figure 7: An MRS for A sauna and a cafeteria are available” (top) and two of sixteen merging config- urations (below). a x a y cafeteria x sauna y and e,x,y available e prop Figure ... edge- ordered and labeled. A solution for a dominance constraint ϕ consists of a tree τ and an ass...

Ngày tải lên: 20/02/2014, 15:21

8 332 0
Báo cáo khoa học: "Extracting Narrative Timelines as Temporal Dependency Structures" ppt

Báo cáo khoa học: "Extracting Narrative Timelines as Temporal Dependency Structures" ppt

... corpora, most existing temporal informa- tion extraction models formulate temporal linking as a pair-wise classification task, where each pair of events and/or times is examined and classified as having ... the LinearSeq base- line was 0.830, suggesting that annotators were most often linking adjacent events. At the same time, the labeled attachment score was 0.581, indicating that even...

Ngày tải lên: 07/03/2014, 18:20

10 332 0
w