Báo cáo khoa học: "Plasma neutrophil gelatinase-associated lipocalin predicts acute kidney injury, morbidity and mortality after pediatric cardiac surgery: a prospective uncontrolled cohort study" pps
... citation purposes) Vol 11 No 6 Research Plasma neutrophil gelatinase-associated lipocalin predicts acute kidney injury, morbidity and mortality after pediatric cardiac surgery: a prospective uncontrolled ... in a small cohort of patients that plasma neutrophil gelatinase-associated lipocalin (NGAL), measured using a research enzyme-linked immunoso...
Ngày tải lên: 13/08/2014, 10:20
... creatinine. Abbreviations AKI: Acute Kidney Injury; AKIN: Acute Kidney Injury Network; ALT: Alanine Aminotransferase; AST: Aspartate Aminotransferase; CABG: Coronary Artery Bypass Graft; CPB: Cardiopulmonary bypass; ... of Anesthesia, revised the draft and gave final approval. MK has performed as Nephrological consultant, did scientific revision and gave final approval. KA has per...
Ngày tải lên: 10/08/2014, 09:23
... a genetic variability in the synthesis of pineal melatonin (Zarazaga et al. 199 8a and Zarazaga et al. 1998b). In contrast to an earlier study (An- dersson et al. 2000), there was no significant ef- fect ... - 20°C until analysed for melatonin content. Melatonin assay Plasma melatonin was analysed by radio im- munoassay (Bhhlmann Laboratories AG, Schö- nenbuch, Switzerland). Before assay,...
Ngày tải lên: 12/08/2014, 15:20
báo cáo khoa học: " Hypothyroidism in a five-year-old boy with rhabdomyolysis and recent history of cardiac tamponade: a case report" pptx
... Ramos 2 , Claudia Lorenzana 2 and Susana Soto 2 Abstract Introduction: Cardiac tamponade is a rare manifestation of hypothyroidism, and a less rare cause of pericardial effusion. The accumulation ... phatic drainage [7]. Cardiac tamponade is probably rare because the pericar- dial effusion accumulation is gradual and allows the pericardium to stretch, allowing normal maintenance...
Ngày tải lên: 10/08/2014, 23:20
Báo cáo khoa học: "Assisted spontaneous breathing during early acute lung injury" potx
... breathing pattern and response to lung collapse, alveolar oedema, and consolidation during ALI/ARDS. Ma and colleagues showed that reflex loops regulating both end-inspiratory and end-expiratory ... mandatory ventilation (CMV), intermittent mandatory ventilation (IMV) and biphasic inter- mittent positive airway pressure (BIPAP) on duration of intu- bation and consumption of analge...
Ngày tải lên: 12/08/2014, 23:21
báo cáo hóa học:"Early initiation of antiretroviral therapy results in decreased morbidity and mortality among patients with TB and HIV" ppt
... initiation of antiretroviral therapy results in decreased morbidity and mortality among patients with TB and HIV Payam Tabarsi* 1 , Ali S Saber-Tehrani 1 , Parvaneh Baghaei 1 , Mojgan Padyab 1 , ... collecting data and preparing the manuscript. PB partic- ipated in collecting data and analyzing data. MP partici- pated in analyzing data. MA participated in the design of the study....
Ngày tải lên: 20/06/2014, 08:20
Báo cáo khoa học: The antibody to GD3 ganglioside, R24, is rapidly endocytosed and recycled to the plasma membrane via the endocytic recycling compartment ppt
... surface at 4 °C was efficiently endocytosed after 15 min at 37 °C. After 30 min, the pool of intracellular antibody had decreased to 25%, and, at 60 and 90 min after internalization, the antibody ... Drug Targets 4, 313–326. 15 Daniotti JL, Martina JA, Giraudo CG, Zurita AR & Maccioni HJ (2000) GM3 alpha2,8-sialyltransferase (GD3 synthase): protein characterization and sub-golgi...
Ngày tải lên: 16/03/2014, 13:20
Báo cáo khoa học: "Plasma haptoglobin and immunoglobulins as diagnostic indicators of deoxynivalenol intoxication" potx
... Animal Welfare Ethics, National Veterinary Research and Quarantine Service, Korea. Chemicals and animal treatment DON, aflatoxin B1 (AFB1) and zearalenone (ZEA) were purchased from Sigma-Aldrich ... expressed as the mean ± SD of six individual animals. Statistical analysis was performed using ANOVA and then Duncan's test. A p value < 0.05 was judged to be significant and...
Ngày tải lên: 07/08/2014, 20:23
báo cáo khoa học: " Plasma levels of leptin and soluble leptin receptor and polymorphisms of leptin gene -18G A and leptin receptor genes K109R and Q223R, in survivors of childhood acute lymphoblastic leukemia" docx
... gene - 18G > A tggagccccgtaggaatcgca tgggtctgacagtctcccaggga PCR-RFLP (AciI) Leptin receptor gene - K109R tttccactgttgctttcgga aaactaaagaatttactgttgaaacaaatggc PCR-RFLP (HaeIII) Leptin receptor ... Scuteri A, Sanna S, Chen WM, Uda M, Albai G, Strait J, Najjar S, Nagaraja R, Orrú M, Usala G, Dei M, Lai S, Maschio A, Busonero F, Mulas A, Ehret GB, Fink AA, Weder AB, Cooper RS, Galan P,...
Ngày tải lên: 10/08/2014, 10:21
báo cáo khoa học: "Plasma protein C levels in immunocompromised septic patients are significantly lower than immunocompetent septic patients: a prospective cohort study" pdf
... 6 Department of Chemical Pathology, Princess Alexandra Hospital, Brisbane, Australia Email: Rakshit Panwar* - rakshitpanwar@hotmail.com; Bala Venkatesh - bala_venkatesh@health.qld.gov.au; Peter Kruger ... Brisbane, Australia, 4 Department of Intensive Care, University of Queensland, Brisbane, Australia, 5 Department of Hematology, Princess Alexandra Hospital, Brisbane, Australia and...
Ngày tải lên: 10/08/2014, 22:20