Báo cáo y học: " A peptide-loaded dendritic cell based cytotoxic T-lymphocyte (CTL) vaccination strategy using peptides that span SIV Tat, Rev, and Env overlapping reading frames" ppt
... CCCATATCCAACAGGACCCGGCACTGCCAACCAGAGAAGGCAAAGAAGGAGACGGTGGAGAAGGCGGTGGCAACAGCTCCTGGCCTTGGCAGATAG L22815 CCCATATCCAACAGGACCCGGCACTGCCAACCAGAGAAGGCAAAGAAGGAGACGGTGGAGAAGGCGGTGGCAACAGCTCCTGGCCTTGGCAGATA. A Y0 72902 CCCATATCCAACAGGACCCGGCACTGCCAACAAGAGAAGGCAAAGAAGGAGACGGTGGAGAAGGCGGTGGCAACAGCTCCTGGCCTTGGCAGATAG A Y0 72903 ... CCCATATCCAACAGGACCCGGCACTGCCAACAAGAGAAGGCAAAGAAGGAGACGGTGGAGAAGGC...
Ngày tải lên: 13/08/2014, 09:21
... distinguishes NeuAc (a2 ,6)Gal/GalNAc from NeuAc (a2 ,3)Gal/GalNAc [8], it is an extremely useful tool for the analysis of sialylated N- and O-glycans [9]. SNA-I was originally isolated from elderberry bark where it ... protein. Assays of the RNA N-glycosylase activity using ribosomes from both animal and plant origin as a substrate yielded identical results for rSNA-If and SNA-If....
Ngày tải lên: 31/03/2014, 23:20
... study, data and statistical analysis and interpretation. FR participated in the data anal- ysis. BHK and CD were responsible for writing the manuscript; MP, GB and CS supervised the study. All authors ... grade and size and nodal status (the latter being negative for all patients in this study). AOL calculates 10-year survival probability based on a patient's age, tumor s...
Ngày tải lên: 09/08/2014, 20:21
Báo cáo y học: "A dynamic model of gene expression in monocytes reveals differences in immediate/early response genes between adult and neonatal cells" potx
... statistically significant for all anal- yses. Analysis of the apoptosis assays was undertaken using both parametric and non-parametric analysis methods. Parametric analysis was undertaken using ... cytometer. Data obtained by flow cytometry was analyzed by non-parametric t-test (Mann-Whitney test). An alpha level of 0.05 was considered statistically signifi- cant. Statistical analysis M...
Ngày tải lên: 11/08/2014, 08:21
Báo cáo y học: "A systematic review of randomized controlled trials exploring the effect of immunomodulative interventions on infection, organ failure, and mortality in trauma patient" ppt
... antigen presentation, referred to as compensatory anti-inflammatory response syndrom e (CARS). Many argue that SIRS and CARS occur simul- taneously as a mixed antagonisticresponsesyndrome (MARS) ... in inflammatory parameters could indicate a n attenuation of SIRS and/ or CARS; however, they were not consis- tently accompanied by significant changes in infection and mort ality rate...
Ngày tải lên: 13/08/2014, 21:21
Báo cáo y học: "A third-generation microsatellite-based linkage map of the honey bee, Apis mellifera, and its comparison with the sequence-based physical map" pps
... average resolution of the map is 2 cM, that is, about 93 kb). In addition, many peaks may correspond to short physical regions that, by chance, have been framed by mark- ers and have shown at least ... file Acknowledgements We thank Martial Marbouty, Marion Segalen, Bertrand Lachaise, Christelle Adam, Laetitia Barrault, Véronique Noël, Laure Riffault, Véronique Henriot and Magally Torr...
Ngày tải lên: 14/08/2014, 07:21
Tài liệu Báo cáo Y học: Binding of gelsolin domain 2 to actin An actin interface distinct from that of gelsolin domain 1 and from ADF/cofilin pptx
... phosphatase-labelled streptavidin (1 : 1000). Con- trol assays were carried out in wells saturated with gelatin and gelatin hydrolysate used alone. Each assay was con- ducted in triplicate and the mean value ... G- and F-actins, promotes nucleation and both severs and caps actin filaments. Cofilin belongs to another family of actin-binding proteins that also severs actin filaments a...
Ngày tải lên: 22/02/2014, 07:20
Báo cáo Y học: A polymer with a backbone of 3-deoxy-D-glycero -D-galacto -non-2ulopyranosonic acid, a teichuronic acid, and a b-glucosylated ribitol teichoic acid in the cell wall of plant pathogenic Streptomyces sp. VKM Ac-2124 pdf
... teichoic acids, the anionic glycopolymers which are covalently bound to peptidoglycan and are situated between other cell wall layers and at the cell surface. They impart a negative charge to the cell ... acid with a disaccharide repeating unit fi6) -a- D -Glcp-(1fi4)-b- D -ManpNAc3NAcA-(1fi,ab-glucosylated polymer of 3-deoxy- D -glycero- D -galacto-non-2-ulopyranosonic acid (Kdn)...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo y học: " A Novel Population of Mesenchymal Progenitors with Hematopoietic Potential Originated from CD14- Peripheral Blood Mononuclear Cell" potx
... src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAA94AAAWQCAIAAAAjjQtaAAAACXBIWXMAABYlAAAWJQFJUiTwAAAYCUlEQVR42uzYMRUAIAxDQcqMTVzhNV3w0OVOQqb/Uue+BQAATNsmAAAAaQ4AAHyVxAoAADDOaw4AANIcAACQ5gAAIM0BAABpDgAA0hwAAJDmAAAgzQEAAGkOAADSHAAAkOYAACDNAQAAaQ4AANIcAACQ5gAAIM0BAABpDgAA0hwAAJDmAAAgzQEAAGkOAADSHAAAkOYAACDNAQAAaQ4AANIcAACQ5gAAIM0BAABpDgAA0hwAAJDmAAAgzQEAAGkOAABIcwAAkOYAAIA0BwAAaQ4AAEhzAACQ5gAA...
Ngày tải lên: 08/08/2014, 18:20
Báo cáo y học: "A cell-cycle independent role for p21 in regulating synovial fibroblast migration in rheumatoid arthritis" pps
... trypan blue. Analysis was performed in triplicate wells and results are expressed as the mean ± standard error (SE). Chemotaxis and checkerboard assays with RA synovial fluid Chemotaxis was performed ... Nonomura Y, Kohsaka H, Nagasaka K, Miyasaka N: Gene transfer of a cell cycle modulator exerts anti-inflammatory effects in the treatment of arthritis. J Immunol 2003, 171:4913-4919....
Ngày tải lên: 09/08/2014, 08:22