Báo cáo y học: " Human T-cell leukemia virus type 2 Tax protein induces interleukin 2-independent growth in a T-cell line" ppt
... type 2 Tax proteins. Retrovirology 20 06, 3 :20 . 36. Iwanaga Y, Tsukahara T, Ohashi T, Tanaka Y, Arai M, Nakamura M, Ohtani K, Koya Y, Kannagi M, Yamamoto N, Fujii M: Human T-cell leukemia virus type ... Oie M, Aki- yama T, Tanaka Y, Gejyo F, Fujii M: PDZ domain-binding motif of human T-cell leukemia virus type 1 Tax oncoprotein aug- ments the transforming ac...
Ngày tải lên: 13/08/2014, 09:20
... Cdc25C at serine 21 6 is mediated pri- marily by Chk1 and other kinases including Chk2 or Cdc25C associated kinase (cTAK1). Chk1 is activated by phosphorylation mediated by ataxia telangiectasia mutated ... signaling in an ATM/chk2-medi- ated pathway dependent manner [55]. Our data indicates that p30 results in G2-M delay by enhancing Chk-1 phos- phorylation. In response to DNA damage,...
Ngày tải lên: 13/08/2014, 05:22
... TTCTCCAGGAACACCTTCAGC A; H1S-1 Fwd CCTGTAAAGAAGAAGGCGGCCAAA; H1S-1 Rev CAGAGAAACTCCGCTACGCTCTTT; H1S -2 Fwd CCCAGTATCTGAGCTTATCACCAAGG; H1S -2 Rev TTTCTTAAGCGCGGCCAGAGAAAC; H1S-3 Fwd CCCGGCTAAGAAGAAGGCAACTAA; H1S-3 ... CCCGGCTAAGAAGAAGGCAACTAA; H1S-3 Rev GAAAGGCCATTGCGCTCCTTAGAA; H1S-4 Fwd CCGGTGTCCGAGCTCATTACTAAA; H1S-4 Rev GCTTTCTTGAGAGCGGCCAAAGAT; EF1α Fwd GCCTCTCCAGGATGTCTACAAA; EF1α R...
Ngày tải lên: 13/08/2014, 06:20
Báo cáo y học: " Human T lymphotropic virus type-1 p30II alters cellular gene expression to selectively enhance signaling pathways that activate T lymphocytes" doc
... Retroviruses 20 00, 16:1603-1606. 48. Mori N, Ueda A, Ikeda S, Yamasaki Y, Yamada Y, Tomonaga M, Mori- kawa S, Geleziunas R, Yoshimura T, Yamamoto N: Human T-cell leukemia virus type I tax activates ... M, Yamamoto N, Fujii M: Human T-Cell Leukemia Virus Type 1 Tax Protein Activates Transcription through AP-1 Site by Inducing DNA Binding Activity in T Cells. Vi...
Ngày tải lên: 13/08/2014, 13:20
Báo cáo y học: "Subacute herpes simplex virus type 1 encephalitis as an initial presentation of chronic lymphocytic leukemia and multiple sclerosis: a case report" doc
... representing a lack of myelin superiorly. B) H&E stain (20 0×) showing a peri-vascular cuff consisting of lymphocytes and histiocytes. C) H&E stain (400×) showing an inflammatory infiltrate ... occipital brain biopsy performed on 15 March 20 09. A) Hematoxylin and eosin (H&E) stain (100×) showing a sharp border between relatively normal neuropil inferiorly and a paler ar...
Ngày tải lên: 11/08/2014, 00:22
Báo cáo y học: " Prevalence of GB virus type C in urban Americans infected with human immunodeficiency virus type 1" ppsx
... Microbiol 20 04, 42: 3915-3919. 2. Toyoda H, Fukuda Y, Hayakawa T, Takamatsu J, Saito H: Effect of GB virus C/hepatitis G virus coinfection on the course of HIV infection in hemophilia patients in Japan. ... prevalence of antibodies against GBV-C envelope glycoprotein E2 and GBV- C viremia in an HIV + inner city population. This study group is predominantly African-American; 41%...
Ngày tải lên: 13/08/2014, 09:21
Báo cáo y học: " Evolution of Dengue Virus Type 3 Genotype III in Venezuela: Diversification, Rates and Population Dynamics" docx
... significant evolutionary change among strains isolated in the initial years and recent strains. Interestingly, strains isolated in Venezuela are not only assigned to Cluster A, but also to Clusters B (strain DENV-3/VE/BID-V911 /20 01) ... Virus Type 3 Genotype III in Venezuela: Diversification, Rates and Population Dynamics Alvaro Ramírez 1† , Alvaro Fajardo 2 , Zoila Moros 1 , M...
Ngày tải lên: 12/08/2014, 02:20
Tài liệu Báo cáo Y học: The binding of lamin B receptor to chromatin is regulated by phosphorylation in the RS region ppt
... [7,8]. A peripheral nuclear membrane protein, Ya, is also known as a chromatin binding protein in e arly embryos of Drosophila melanogaster [9]. LAP2 was found as lamina-associated polypeptides in ... Instrumental Analysis, Niigata University, Japan Binding of lamin B receptor (LBR) to chromatin was studie d by means o f an in vitro assay system involving recombinant fragments o...
Ngày tải lên: 22/02/2014, 04:20
Báo cáo Y học: Expression and distribution of penaeidin antimicrobial peptides are regulated by haemocyte reactions in microbial challenged shrimp pptx
... obtained, respectively, for pen- 3a transcripts and 18 S rRNA probes were quantified by STORM and analysed separately. Data analysis revealed an important individual variation in both pen- 3a transcripts and ... population involved in a phenomenon of lysis with a massive and early release of penaeidins; and (b) another population involved in phagocytosis of bacteria taking place la...
Ngày tải lên: 18/03/2014, 01:20
Báo cáo hóa học: " Human cord blood progenitors with high aldehyde dehydrogenase activity improve vascular density in a model of acute myocardial infarction" ppt
... 56 (2) :393. 22 . Fukuchi Y, Miyakawa Y, Kizaki M, Umezawa A, Shimamura K, Kobayashi K, Kuramochi T, Hata J, Ikeda Y, Tamaoki N, et al: Human acute myeloblastic leukemia- ascites model using the human ... in parallel. Mice were sacrificed 48 - 72 hours post transplantation and organs were har- vested,rinsedinPBSandanalyzedonaKodak4000 MM CCD/X-ray imaging station (Molecular Imagi...
Ngày tải lên: 18/06/2014, 16:20