Báo cáo y học: " Nuclear Factor 90, a cellular dsRNA binding protein inhibits the HIV Rev-export function" pps

Báo cáo y học: " Nuclear Factor 90, a cellular dsRNA binding protein inhibits the HIV Rev-export function" pps

Báo cáo y học: " Nuclear Factor 90, a cellular dsRNA binding protein inhibits the HIV Rev-export function" pps

... 5'GGGGGGGAATTCGCTAGCCGCCACCAATGAAGAACCCAGTCATGGAGCTG3' 3-primer: 5'GGGGGGCCCGGGGCGGCCGACTAAGGGAAAAGTTTTTCTAGGGCAGCAAG3' DRBD 2 pCI-neo/DRBD 2 NF90 5'-primer: 5'GGGGGGGTCGACCGCCACCAATGAAGCTTTTCCCTGACACCCCTCTCGCC3' 3'-primer: ... Construct 5'-primer: 5'GGGGGGGAATTCGCTAGCCGCCACCAATGCAGAAGACGGAGCACATGAC3' 3'-primer: 5'GGGGGGCCCGGGGC...

Ngày tải lên: 13/08/2014, 09:20

13 210 0
Báo cáo y học: "Nuclear Factor 90(NF90) targeted to TAR RNA inhibits transcriptional activation of HIV-1" potx

Báo cáo y học: "Nuclear Factor 90(NF90) targeted to TAR RNA inhibits transcriptional activation of HIV-1" potx

... speculated that mammalian cells employ RNA interference (RNAi) pathway as an antiviral mechanism. The HIV- 1 TAR RNA binding protein (TRBP) has an essential role in HIV repli- cation as well as in ... that perturbation Tat/TAR RNA interaction by the dsRNA binding protein is sufficient to inhibit transcriptional activation of HIV- 1. Background Highly Active Antiretroviral Th...

Ngày tải lên: 13/08/2014, 05:22

10 334 0
Báo cáo y học: "Antiviral activity of a-helical stapled peptides designed from the HIV-1 capsid dimerization domain" pps

Báo cáo y học: "Antiviral activity of a-helical stapled peptides designed from the HIV-1 capsid dimerization domain" pps

... microscopy, isothermal titration calorimetry and sedimentation equilibrium analyses and analyzed data; FC carried out the antiviral assays and analyzed data; XZ helped in preparing and purifying proteins; ... soluble analog of NYAD- 201. We also synthesized the linear analog of NYAD- 201 (NYAD-209) and a mutant analog of NYAD-201 (NYAD-233) after mutating two key dimer-interface residue...

Ngày tải lên: 13/08/2014, 01:20

18 232 0
Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf

Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf

... suggest that certain enzymes, and therefore the corresponding genes of the A2 0 1A biosyn- thetic pathway, may be related to their counterparts of the puromycin and hygromycin A biosynthetic pathways, respectively. The ... active against Gram positive aerobic and anaerobic bacteria and most Gram negative anaerobic species. In contrast, it has a low toxicity for aerobic Gram nega...

Ngày tải lên: 21/02/2014, 01:21

9 728 0
Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx

Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx

... to protein -A Sepharose, washed and separated by SDS/PAGE. The immunostaining of Western blot was performed by commercially available, high affinity anti-(b-galactosidase) Ig. Anti-(b-galactosidase) ... quantitative and qualitative assays for b-galactosidase (activation of LacZ reporter gene). BD, pGBT9; BD*, pAS2-1; AD, pGAD424; AD**, pACT2. Activity values are given as mean values ± stan...

Ngày tải lên: 21/02/2014, 15:20

10 465 0
Báo cáo y học: "Preliminary evidence for a change in spectral sensitivity of the circadian system at night" potx

Báo cáo y học: "Preliminary evidence for a change in spectral sensitivity of the circadian system at night" potx

... could mathematically represent both the pupil and iris. A rela- tive measurement, referred to as relative pupil area (rPA) was obtained by dividing the pupil area by the iris area. Only the rPA values ... interpre- tation. MSR conceived the study, helped to collect the data, par- ticipated in the data analyses and interpretation, and helped to draft the manuscript. All autho...

Ngày tải lên: 10/08/2014, 09:20

9 363 0
Báo cáo y học: "Giant renal oncocytoma: a case report and review of the literatur" pps

Báo cáo y học: "Giant renal oncocytoma: a case report and review of the literatur" pps

... can coexist with oncocytoma. Renal oncocytomas are almost invariably benign and no cases of metastasis have been reported. Even when very large, they are generally well encapsulated and are rarely ... intra-abdominal mass and antero- lateral displacement of the left ureter. A contrast-enhanced axial computed tomography image shows a huge, capsulated, heterogeneously enhancing mass ori...

Ngày tải lên: 11/08/2014, 11:22

5 358 0
Báo cáo y học: " Mycosis fungoides bullosa: a case report and review of the literature" pps

Báo cáo y học: " Mycosis fungoides bullosa: a case report and review of the literature" pps

... subcorneal and intra-epidermal bullae accompanied by infiltra tes of atypica l lympho- cytes. The latter were characterised by a marked epidermotropism and the formation of Pautrier micro- abscesses ... forma tion [6]. Alternatively, prolif- eration of neoplastic lymphocytes may result in a loss of coherence between basal keratinocytes and basal lamina [7] or the cohesion of keratin...

Ngày tải lên: 11/08/2014, 11:23

3 340 0
Báo cáo y học: " Oral vaccination with a recombinant Salmonella vaccine vector provokes systemic HIV-1 subtype C Gag-specific " ppt

Báo cáo y học: " Oral vaccination with a recombinant Salmonella vaccine vector provokes systemic HIV-1 subtype C Gag-specific " ppt

... the Gag by the recombinant Salmonella vaccine (aroC+Gag) was determined by SDS-PAGE and (C) the Roche Elecsys ® HIV p24 Ag assay. In the Roche Elecsys ® HIV p24 Ag assay, total bacterial ... recombinant Salmonella. At sacrifice, 28 days after the last immunization, systemic CD4+ Th1 and Th2 cytokine responses were evaluated by enzyme-linked immunospot assay and cytometric be...

Ngày tải lên: 12/08/2014, 04:21

9 217 1
Báo cáo y học: " Sputum neutrophils as a biomarker in COPD: findings from the ECLIPSE study" pdf

Báo cáo y học: " Sputum neutrophils as a biomarker in COPD: findings from the ECLIPSE study" pdf

... principally a tool to assess the burden of airway inflammation; it is not a major sur- rogate of the other clinical and pathophysiological abnor- malities measured in this study. Generally, any weak ... Germany) according to the manufac- turer's instructions. The assay had a validated range of 1.56 to 100 ng/mL. A high sensitivity, sandwich enzyme- linked immunoassay (Sea...

Ngày tải lên: 12/08/2014, 11:22

12 379 0
w