Báo cáo y học: " Nuclear Factor 90, a cellular dsRNA binding protein inhibits the HIV Rev-export function" pps
Báo cáo y học: " Nuclear Factor 90, a cellular dsRNA binding protein inhibits the HIV Rev-export function" pps
... 5'GGGGGGGAATTCGCTAGCCGCCACCAATGAAGAACCCAGTCATGGAGCTG3'
3-primer: 5'GGGGGGCCCGGGGCGGCCGACTAAGGGAAAAGTTTTTCTAGGGCAGCAAG3'
DRBD 2 pCI-neo/DRBD 2 NF90
5'-primer: 5'GGGGGGGTCGACCGCCACCAATGAAGCTTTTCCCTGACACCCCTCTCGCC3'
3'-primer: ... Construct
5'-primer: 5'GGGGGGGAATTCGCTAGCCGCCACCAATGCAGAAGACGGAGCACATGAC3'
3'-primer: 5'GGGGGGCCCGGGGC...
Báo cáo y học: "Nuclear Factor 90(NF90) targeted to TAR RNA inhibits transcriptional activation of HIV-1" potx
... speculated
that mammalian cells employ RNA interference (RNAi)
pathway as an antiviral mechanism. The HIV- 1 TAR RNA
binding protein (TRBP) has an essential role in HIV repli-
cation as well as in ... that perturbation Tat/TAR RNA interaction by the dsRNA binding protein is sufficient
to inhibit transcriptional activation of HIV- 1.
Background
Highly Active Antiretroviral Th...
Báo cáo y học: "Antiviral activity of a-helical stapled peptides designed from the HIV-1 capsid dimerization domain" pps
... microscopy, isothermal titration calorimetry and
sedimentation equilibrium analyses and analyzed data; FC carried out the
antiviral assays and analyzed data; XZ helped in preparing and purifying
proteins; ... soluble analog of NYAD-
201. We also synthesized the linear analog of NYAD-
201 (NYAD-209) and a mutant analog of NYAD-201
(NYAD-233) after mutating two key dimer-interface
residue...
Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf
... suggest that certain enzymes, and
therefore the corresponding genes of the A2 0 1A biosyn-
thetic pathway, may be related to their counterparts of the
puromycin and hygromycin A biosynthetic pathways,
respectively.
The ... active
against Gram positive aerobic and anaerobic bacteria and
most Gram negative anaerobic species. In contrast, it has
a low toxicity for aerobic Gram nega...
Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx
... to protein -A Sepharose,
washed and separated by SDS/PAGE. The immunostaining
of Western blot was performed by commercially available,
high affinity anti-(b-galactosidase) Ig.
Anti-(b-galactosidase) ... quantitative and qualitative assays for b-galactosidase (activation of LacZ reporter gene). BD, pGBT9; BD*, pAS2-1; AD, pGAD424;
AD**, pACT2. Activity values are given as mean values ± stan...
Báo cáo y học: "Preliminary evidence for a change in spectral sensitivity of the circadian system at night" potx
... could
mathematically represent both the pupil and iris. A rela-
tive measurement, referred to as relative pupil area (rPA)
was obtained by dividing the pupil area by the iris area.
Only the rPA values ... interpre-
tation.
MSR conceived the study, helped to collect the data, par-
ticipated in the data analyses and interpretation, and
helped to draft the manuscript.
All autho...
Báo cáo y học: "Giant renal oncocytoma: a case report and review of the literatur" pps
... can
coexist with oncocytoma.
Renal oncocytomas are almost invariably benign and
no cases of metastasis have been reported. Even when
very large, they are generally well encapsulated and are
rarely ... intra-abdominal mass and antero-
lateral displacement of the left ureter.
A contrast-enhanced axial computed tomography image
shows a huge, capsulated, heterogeneously enhancing
mass ori...
Báo cáo y học: " Mycosis fungoides bullosa: a case report and review of the literature" pps
... subcorneal and intra-epidermal
bullae accompanied by infiltra tes of atypica l lympho-
cytes. The latter were characterised by a marked
epidermotropism and the formation of Pautrier micro-
abscesses ... forma tion [6]. Alternatively, prolif-
eration of neoplastic lymphocytes may result in a loss of
coherence between basal keratinocytes and basal lamina
[7] or the cohesion of keratin...
Báo cáo y học: " Oral vaccination with a recombinant Salmonella vaccine vector provokes systemic HIV-1 subtype C Gag-specific " ppt
... the
Gag by the recombinant Salmonella vaccine (aroC+Gag) was
determined by SDS-PAGE and (C) the Roche Elecsys
®
HIV
p24 Ag assay. In the Roche Elecsys
®
HIV p24 Ag assay, total
bacterial ... recombinant Salmonella. At sacrifice, 28 days after the last immunization, systemic CD4+ Th1
and Th2 cytokine responses were evaluated by enzyme-linked immunospot assay and cytometric
be...
Báo cáo y học: " Sputum neutrophils as a biomarker in COPD: findings from the ECLIPSE study" pdf
... principally a tool to assess
the burden of airway inflammation; it is not a major sur-
rogate of the other clinical and pathophysiological abnor-
malities measured in this study.
Generally, any weak ... Germany) according to the manufac-
turer's instructions. The assay had a validated range of
1.56 to 100 ng/mL. A high sensitivity, sandwich enzyme-
linked immunoassay (Sea...