... 501 Smyth Rd., Ottawa, Canada. 2 Department of Biochemistry, Microbiology and Immunology, University of Ottawa, 450 Smyth Rd., Ottawa, Canada. 3 Division of Infectious Diseases, Ottawa Hospital-General ... In the first round of PCR, DNA (1/10) was amplified with outer P24 primers (400 nm) forward (fwd): 5’-ATAGAGGAAGAGCAAAA- CAAAA-3’ ; reverse (rvs): 5’ -GTTCCTGAAGGGTAC- TAGTAGT-3’. T...
Ngày tải lên: 13/08/2014, 01:21
Báo cáo y học: " HIV infection of non-dividing cells: a divisive problem" ppt
... is generally measured by p24 gag ELISA or by enzymatic RT assays and both assays have higher variability than GFP detection by FACS in single cycle assays. Thus, if the vari- ability of the detection ... mutagenesis of IN into a clear phenotype of reduced HIV- 1 nuclear import. Remarkably, a recent study has analysed the phenotype of HIV- 1 chimeric viruses bearing MLV IN in pl...
Ngày tải lên: 13/08/2014, 09:20
... followed by glomangioma. Gloman- giomyoma is the rarest variant with a frequency as low as 8% of a ll glomus tumours [4]. Glom us tumors are highly vascular, and are usually solitary, caused by a proliferation ... 2007, 134:373-377. 10. Takahashi N, Oizumi H, Yanagawa N, Sadahiro M: A bronchial glomus tumor surgically treated with segmental resection. Interact Cardiovasc Thorac Surg...
Ngày tải lên: 10/08/2014, 09:22
Báo cáo y học: "Endoscopic management of biliary fascioliasis: a case report" ppt
... report Rajan F Ezzat * , Taha A Karboli, Kalandar A Kasnazani, Adnan MH Hamawandi Abstract Introduction: Fasciola hepatica, an endemic parasite common in Iraq and its neighboring countries, is a very ... cholangiopancreatography is available, the disease can be easily diagnosed and treated. Introduction Fasciola hepatica (FH) is a leaf-shaped trematode t hat usually attacks cattle and...
Ngày tải lên: 11/08/2014, 12:20
Báo cáo y học: " Targeted infection of HIV-1 Env expressing cells by HIV(CD4/CXCR4) vectors reveals a potential new rationale for HIV-1 mediated down-modulation of CD4" doc
... and (-) CAAGTTAACAGCACTATTC and the fusion primers (+) GGGATATTGATGTCTGTAGAATAGGAGCTTTGTTCCTT- GGG and (-) CCCAAGGAACAAAGCTCCTATTCTACAGT- CATCAATATCCC produced a 1457 bp fragment with a 1448 bp ... It was cleaved with EcoRI and HpaI. (C): A 240 bp fragment, containing the poly (A) site of SV40, was amplified using (+) TAGCCCGGGATAAGATACATTGATGAGT and (-) TAG- GAATTCATCATAATCAGCCATACCA...
Ngày tải lên: 13/08/2014, 09:21
Báo cáo y học: " Pathogenic infection of Macaca nemestrina with a CCR5-tropic subtype-C simian-human immunodeficiency virus" pps
... (Figs. 1A and 4A) . Necropsy revealed a near-occlusive pulmonary arterial thrombus. The clinical history of L03165 indicated a dramatically reduced platelet count and a moderate decrease in the albumin:globulin ... loads Viral load was assayed as previously described [72,78]. Briefly, viral RNA load in EDTA-anticoagulated, cell-free plasma was determined by real-time RT-PCR after rev...
Ngày tải lên: 12/08/2014, 23:21
Báo cáo y học: "Surgical Treatment of Depressed Scar: A Simple Technique"
... Hospital “Fatebenefratelli”, Rome, Italy 4. Department of Maxillofacial Surgery, Calabrodental, Crotone, Italy 5. Department of Dental Sciences and Surgery, General Hospital, Bari, Italy 6. Department ... Sciences and Surgery, General Hospital, Bari, Italy 2. Department of Medical Biochemistry, Medical Biology and Physics, General Hospital, Bari, Italy 3. Department of “Head and...
Ngày tải lên: 25/10/2012, 11:00
Báo cáo y học: "The characterisation of mucin in a mature ovarian teratoma occurring in an eight year old patient
... of a benign cystic teratoma. Figure 1. Histology of a mature ovarian teratoma. Colonic type mucosa lining a cyst within the mature cystic teratoma (H & E, 40X) (a) and respiratory ... Novacastra Laboratories (Newcastle-Upon-Tyne, UK). The antibody to MUC5B was from Santa Cruz Laboratories. Secondary antibodies, Envision labeled polymer–HRP anti mouse antibody and mono...
Ngày tải lên: 26/10/2012, 10:03
Tài liệu Báo cáo Y học: Dynamic mechanism of nick recognition by DNA ligase ppt
... Chang, C., Eom, S.H., Hwang, K .Y. & Cho, Y. , Yu, Y. G., Ryu, S.E., Kwon, S.T. & Suh, S.W. (2000) Crystallization and preliminary X-ray crystallographic analysis of NAD + -dependent DNA ... 12, 861–867. 30. Hakansson,K.,Doherty ,A. J.,Shuman,S.&Wigley,D.B.(1997) X-ray crystallography reveals a large conformational change during guanyl transfer by mRNA capping enzymes. Cell...
Ngày tải lên: 21/02/2014, 01:21
Tài liệu Báo cáo Y học: Differential response of neuronal cells to a fusion protein of ciliary neurotrophic factor/soluble CNTF-receptor and leukemia inhibitory factor pot
... enhanced interleukin-6 type pleiotropic activities. Eur. Cyt. Netw. 8, 359–365. 36. Fukada, T., Hibi, M., Yamanaka, Y. , Takahashi Tezuka, M., Fujitani, Y. , Yamaguchi, T., Nakajima, K. & Hirano, ... reflected by the activation pattern of STAT3 and MAP kinases, mainly p42, were identical for BAF/3 cells stimulated with Hyper-IL-6, Hyper-CNTF, and LIF. Analysis of the biological activ...
Ngày tải lên: 22/02/2014, 07:20