Báo cáo y học: "Characterization of HIV-1 subtype C envelope glycoproteins from perinatally infected children with different courses of disease" ppsx

Báo cáo y học: "Characterization of HIV-1 subtype C envelope glycoproteins from perinatally infected children with different courses of disease" ppsx

Báo cáo y học: "Characterization of HIV-1 subtype C envelope glycoproteins from perinatally infected children with different courses of disease" ppsx

... 275(8):606-610. BioMed Central Page 1 of 15 (page number not for citation purposes) Retrovirology Open Access Research Characterization of HIV-1 subtype C envelope glycoproteins from perinatally infected children ... RA: Characterization of human immunodeficiency virus type 1-specific cytotoxic T lymphocyte clones isolated during acute seroconversion: recognition of...

Ngày tải lên: 13/08/2014, 09:20

15 208 0
Báo cáo y học: "Polymorphism in the tumour necrosis factor receptor II gene is associated with circulating levels of soluble tumour necrosis factor receptors in rheumatoid arthritis" ppsx

Báo cáo y học: "Polymorphism in the tumour necrosis factor receptor II gene is associated with circulating levels of soluble tumour necrosis factor receptors in rheumatoid arthritis" ppsx

... Identification of two types of tumor necrosis factor receptors on human cell lines by monoclonal antibodies. Proc Natl Acad Sci USA 1990, 87:3127-3131. 5. Dembic Z, Loetscher H, Gubler U, Pan YC, ... release of sTNF-RII may reduce the ability of cells to be activated by interactions with membrane bound TNF-α on surrounding cells) [42]. Localized differences in the concentrations of...

Ngày tải lên: 09/08/2014, 07:20

8 390 0
Báo cáo y học: "Human articular chondrocytes produce IL-7 and respond to IL-7 with increased production of matrix metalloproteinase-13" ppsx

Báo cáo y học: "Human articular chondrocytes produce IL-7 and respond to IL-7 with increased production of matrix metalloproteinase-13" ppsx

... evaluated by flow cytometry, immunocytochemical staining, and PCR. Results IL-7 was found to be produced by chondrocytes treated with fibronectin fragments. Compared with cells isolated from normal young ... inducing matrix degrading enzymes directly, these cytokines can also act by stimulating production of additional proinflammatory cytokines. IL-6 is among the cytokines produced by...

Ngày tải lên: 09/08/2014, 10:23

10 342 0
Báo cáo y học: "Clinical symptoms and performance on the continuous performance test in children with attention deficit hyperactivity disorder between subtypes: a natural " doc

Báo cáo y học: "Clinical symptoms and performance on the continuous performance test in children with attention deficit hyperactivity disorder between subtypes: a natural " doc

... Liao Q: The influence of race and ethnicity on psychiatric diagnoses and clinical characteristics of children and adolescents in children s services. Cultur Divers Ethnic Minor Psychol 2007, 13:18-25. Pre-publication ... structure of factors produced by principal components analysis of ADHD measures a,b Factor 1 (CPT distraction) Factor 2 (CPT impulsivity) Factor 3 (Clinical hypera...

Ngày tải lên: 11/08/2014, 15:22

10 593 0
Báo cáo y học: "Characterization of Human Erythrocytes as Potential Carrier for Pravastatin: An In Vitro Study"

Báo cáo y học: "Characterization of Human Erythrocytes as Potential Carrier for Pravastatin: An In Vitro Study"

... erythrocytes either by physical methods such as endocytosis and osmosis-based systems or by chemical perturbation of the erythrocytes membrane [16]. Endocytosis is the process by which cells ... pharmacology of 3-hydroxy-3-methylglutaryl coenzyme a reductase inhibitors. Life Sciences. 1999;65(13):1329-1337. 3. Williams D, Feely J. Pharmacokinetic-pharmacodynamic drug interactions...

Ngày tải lên: 25/10/2012, 11:10

9 829 0
Báo cáo y học: "Characterization of erythrovirus B19 genomes isolated in liver tissues from patients with fulminant hepatitis and biliary atresia who underwent liver transplantation"

Báo cáo y học: "Characterization of erythrovirus B19 genomes isolated in liver tissues from patients with fulminant hepatitis and biliary atresia who underwent liver transplantation"

... infection remains conjectural. An immunologi- cally-mediated mechanism of B19-induced hepatocyte destruction has been postulated, but not documented. Thus, there could be an unsuspected cofactor ... severity of associated liver disease, and that the difference between symp- tomatic and asymptomatic infection, may also occur as well as HBV and HCV. Furthermore, among each genotype, sp...

Ngày tải lên: 26/10/2012, 10:03

5 526 0
Báo cáo y học: "Characterization of N200 and P300: Selected Studies of the Event-Related Potential Salil H. Patel 1 and Pierre N. Azzam 2"

Báo cáo y học: "Characterization of N200 and P300: Selected Studies of the Event-Related Potential Salil H. Patel 1 and Pierre N. Azzam 2"

... is a time-locked measure of electrical activity of the cerebral surface representing a distinct phase of cortical processing. Two components of the ERP which bear special importance to stimulus ... post- exercise period after aerobic muscle activity is associated with increased P3 amplitude, with respect to auditory discrimination [83]. Additionally, glycemic status of affect...

Ngày tải lên: 02/11/2012, 11:08

8 563 0
Tài liệu Báo cáo Y học: Characterization of an omega-class glutathione S-transferase from Schistosoma mansoni with glutaredoxin-like dehydroascorbate reductase and thiol transferase activities pptx

Tài liệu Báo cáo Y học: Characterization of an omega-class glutathione S-transferase from Schistosoma mansoni with glutaredoxin-like dehydroascorbate reductase and thiol transferase activities pptx

... [35]. Structure accuracy was assayed by WhatCheck tool in the same environment. As can be observed in Fig. 7(A), only N-terminal SmGSTO domain structure could be predicted with accuracy. The program was ... parasitic stages than in free living stages during the S. mansoni life cycle. Characterization of recombinant SmGSTO enzymatic activity Recombinant GSTO was used to assay its enzymatic...

Ngày tải lên: 21/02/2014, 01:21

10 638 0
Tài liệu Báo cáo Y học: Characterization of a cloned subtilisin-like serine proteinase from a psychrotrophic Vibrio species doc

Tài liệu Báo cáo Y học: Characterization of a cloned subtilisin-like serine proteinase from a psychrotrophic Vibrio species doc

... alginolyticus [42]: 5¢-GCG GAATTCTACACCCGCTACATGTGGCGTCG CCAT-3¢ and 5¢-CGC GGATCCTGGGGACTAGATC GAATC-GACCAACGTAA-3¢. Underlined are restriction enzyme sites for EcoRI and BamHI, respectively. The primers ... d’Amico, D. & Gerday, C. (1999) Thermodynamic stability of a cold-active a-amylase from the Antarctic bacterium Alteromonas haloplanktis. Biochemistry 38, 4613–4619. 30. D’Amico...

Ngày tải lên: 21/02/2014, 01:21

11 551 0
Tài liệu Báo cáo Y học: Characterization of a novel silkworm (Bombyx mori ) phenol UDP-glucosyltransferase potx

Tài liệu Báo cáo Y học: Characterization of a novel silkworm (Bombyx mori ) phenol UDP-glucosyltransferase potx

... enzymes catalyze the addition of the glycosyl group from a nucleotide s ugar to a variety of small hydrophobic m olecules (aglycones), result- ing in m ore hydrophilic compoun ds that are e fficiently excreted. ... yme activity. Keywords: Bombyx mori; detoxication; insect; UDP- glycosyltransferase. The UDP-glycosyltransferases ( UGTs) are a superfamily of enzymes that p lay a central r...

Ngày tải lên: 22/02/2014, 04:20

7 471 0
Từ khóa:
w