Báo cáo y học: "Cardiac arrest following a glucose 30% bolus: what happened" pps

... hyponatremia nor hypocalcemia, both of which Letter Cardiac arrest following a glucose 30% bolus: what happened? Philippe Goutorbe 1 , Nadia Kenane 1 , Julien Bordes 1 , Christophe Jego 2 , Ambroise ... cardiac rhythm had been normal before the glucose bolus was given, but sinus arrest with junctional or idioventricular escape rhythm developed at the end of bolus administrat...

Ngày tải lên: 13/08/2014, 08:21

... 5:333 http://www.jmedicalcasereports.com/content/5/1/333 Page 3 of 5 CASE REP O R T Open Access Cardiac arrest provoked by itraconazole and amiodarone interaction: a case report Angeliki M Tsimogianni * , Ilias Andrianakis, Alex Betrosian and Emmanouil ... case reported o f cardiac arrest due to inte raction of itraconazole and amiodarone. Case report A 65-year-old Caucasian man with...

Ngày tải lên: 10/08/2014, 23:22

... surgical trauma in patients who are already very sick. On the contrary, the risk of potential peritoneal contamination seems to be negligible. Laparotomy may lead to post- operative pain that may ... Anaesthesiology and Reanimation, Medicana Hospitals Camlica, Istanbul, Turkey. 3 Department of Pediatric Cardiology, Dr. Siyami Ersek Thoracic and Cardiovascular Surgery Center, Istanbul, Turkey....

Ngày tải lên: 10/08/2014, 09:21

... Levatiracetam were tried in a few cases. In our patient, various medical treatments were applied (Clonazepam 6 mg/day, Carbamazepine 800 mg/ day, Na valproate 1000 mg/day, Piracetam 4.8 g/day) but no ... it was not stimulus-sensitive. As a result of clinical, laboratory, radiological and electro- physiological evaluations, the patient was diagnosed as having a non-proprioceptive spinal...

Ngày tải lên: 10/08/2014, 10:20

... dopamine agonists for Par- kinson's disease. N Engl J Med 2007, 356:39-46. 7. Yamamoto M, Uesugi T, Nakayama T: Dopamine agonists and cardiac valvulopathy in Parkinson's disease: a case-control study. ... Patras, Greece and 3 Department of Anaesthesiology and Critical Care Medicine, University of Patras, School of Medicine. Patras, Greece Email: Efstratios E Apostolakis - strati...

Ngày tải lên: 10/08/2014, 10:20

... share some limita tions.  ey all included a limited number of patients. Due to the rapid time-dependant variations of ADC, MRI can only be performed early (2 to 5 days) after the cardiac arrest, ... thresholds correlated with clinical outcome with a better sensitivity than clinical examination. A study by Wu and colleagues [3] basically combined these two approaches and found sim...

Ngày tải lên: 13/08/2014, 20:21

... cell cycle and survival of cancer. XB130 specifically binds p8 5a subunit of PI3K, which subsequently activate Akt. Akt plays an essential role in cell proliferation and survival. Shiozaki and Liu ... transfected thyroid cancer cells. Among them, 57 genes are related to cell proliferation or survival, including many transcription regulators. Pathway analysis showed that the top ranked diseas...

Ngày tải lên: 10/08/2014, 09:22

... (CTGCCCT- GTATCATCTGAACC) and T3R3 4a (CTCCCCTGAC ATT CAACGC) amplifying the gag gene of the viral genome whereas for the murine hybrid retrovirus primers T3R27s2 (CAGGGAGAACATGGTAATAGGA) and T3R2 7a2 (ACGACCTCTCCAAAGTATCCA) ... SMRV- 805 7a (GTAGGAGGGGAACCGGCTAC) for SMRV and T3R03s (AGGGGATTTATTGGATACACG), T3R3 2a (CATCGTGACCTGGGAAGC) for the murine retrovirus. PCR products were sequenc...

Ngày tải lên: 12/08/2014, 23:22

... fibrotic rats Rhizoma Zingiberis, Ramulus Cinnmomi, Radix Aconiti Lateralis preparata, Radix Astragali, Radix Bupleuri, Fructus Aurantii, Rhizoma Atractylodis macrocephalae, Radix Glycyrrhizae Fuzheng ... diuretic effects of Wakan-yaku prescription on normal rats and vari- ous pathological models. Wakan Iyakugaku Zasshi 1996, 13:484-485. 98. Feng Y, Nagamatu T, Suzuki Y, Kawata T, Feng Y...

Ngày tải lên: 13/08/2014, 15:21

... of various sizes (black arrows). Papathanassiou et al. Clinical Sarcoma Research 2011, 1:3 http://www.clinicalsarcomaresearch.com/content/1/1/3 Page 9 of 11 that are usually painless and relative ... (asterisk). Figure 2 Axial contrast-enhanced CT scan: Delineation of vessels (black arrows and arrowheads) is apparent on enhanced images. Papathanassiou et al. Clinical Sarcoma Research 2011, 1:...

Ngày tải lên: 13/08/2014, 15:21