... 5'-CTGGCTACCTGAGTGAAGATGGAGA- 3', antisense 5'-AAAGACCTCCCCTCCGATGTAGTAG-3' Smad4: sense 5'-GTATAATGCCACCAGTACCACCAAC-3', antisense 5'-TGACCCAAGCAAAAGCGATCTCCTC -3' G6PD: ... was administered intravenously to the bleomycin-treated mice (day0). AG was orally administered daily to the mice of groups 1 and 3 (day -3 to day 27). EM703 was orally admin...
Ngày tải lên: 12/08/2014, 16:20
... expiratory time by increasing the inspiratory flow rate and decreasing the plateau time. However, a reduction in inspiratory time and in the ratio of inspiratory to expiratory time may have a negative ... established, and anyone involved in the ventilatory management of any kind of patient (not just ALI/ARDS patients) should be aware of them and measure auto-PEEP. Au...
Ngày tải lên: 12/08/2014, 19:22
Báo cáo y học: "Report from Mongolia – How much do we know about the incidence of rare cases in less developed countries: a case series" ppsx
... gathered the data, interpreted the data and helped in drafting the manuscript. AHR gathered the data and helped in drafting the manuscript. WRH interpreted the data and helped in drafting the manuscript. ... processes. Conclusion The global incidence of rare cases may be underestimated by contemporary international databases. Diseases which are currently considered t...
Ngày tải lên: 11/08/2014, 19:21
Báo cáo y học: " Pregnancy and delivery while receiving vagus nerve stimulation for the treatment of major depression: a case report" pot
... motor activity, heart rate variability [15], and blunted pain response [19,20]. Increased dosing of SSRIs may be required to maintain euthymia during later stages of pregnancy [21], which may exacerbate ... contributions MMH was the principal investigator of the VNS pilot study. DS was the study coordinator. KT assisted in data analysis and manuscript preparation. Acknowledgemen...
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: " Hepatocyte growth factor prevents lupus nephritis in a murine lupus model of chronic graft-versus-host disease" ppt
... coordination of the study, and participated in the interpretation of the results. JF participated in the HGF gene preparation and transfection. HS participated in the design and interpretation of the ... may represent a novel strategy for the treat- ment of systemic lupus erythematosus, Sjogren's syndrome and primary biliary cirrhosis. Competing interests T...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "Thymic function and T cell parameters in a natural human experimental model of seasonal infectious diseases and nutritional burden" potx
... using insecticide- treated bed nets and targeted chemoprophylaxis in a rural area of The Gambia, west Africa. 1. A review of the epidemiology and control of malaria in The Gambia, west Africa. Trans ... designed the study and participated in drafting the manuscript. PTN did the laboratory work including all the molecular analyses. JS participated in the field...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: " Abnormal macrophage response to microbial stimulus in a 43-year-old man with a severe form of atherosclerosis: a case report" pptx
... of risk factors may contribute to the assessment of the efficacy of drug therapy. Introduction Atherosclerosis is the leading cause of death in the majority of industrialized countries. The absence ... ischemic lesions and gliosis in the cerebral white matter, mainly in the semi-oval center and the corona radiata. Figure 2 Abdominal computed tomography angiog...
Ngày tải lên: 11/08/2014, 12:20
Báo cáo y học: "F-18-fluorodeoxyglucose positron emission tomography-computed tomography for the diagnosis of Takayasu''''s arteritis in stroke: a case report" pptx
... transcra- nial and extracranial ultrasound was normal, abdominal CT showed an aneurysm of the infrarenal aorta with a diameter of 4.8 cm and a marginal thrombus (Figure 1C and 1D). CT angiography of ... infarction, intracerebral hemorrhage, and orthostatic syncopal attacks [1]. Typically, early symp- toms of systemic inflammatory disease are followed by inflammation of the...
Ngày tải lên: 11/08/2014, 21:22
Báo cáo y học: " Pioglitazone is as effective as dexamethasone in a cockroach allergen-induced murine model of asthma" doc
... 5' GCTGAACACCTCACTGCTTGG 3' Probe 5' CAACAACGACGAGAAGTTCTACTTATCCAAAG G 3' Muc5-ac forward 5' CCAGCACCATCTCTACAACCC 3' reverse 5' GCAAAGCTCCTGTTTGCACTC 3' Probe ... monitored. The peak airway resist- ance was recorded as a measure of airway hyperreactivity. Enzyme-linked immunosorbent assays (ELISAs) The levels of cytokine and chemokine prote...
Ngày tải lên: 12/08/2014, 15:21
Báo cáo y học: "End-tidal carbon dioxide monitoring during bag valve ventilation: the use of a new portable device" pptx
... used as an auxiliary tool for evaluating the accuracy of bag-valve mask ventilation. The main conclusion is that when patients are well under anaes- thesia, are hemodynamically stable and adequately ... until the patients were fully anaesthe tized and hemodynami- cally stable. The patients chosen were all ASA I and II and therefore easily mainta ined. A weakness could be thediffic...
Ngày tải lên: 13/08/2014, 23:20