Báo cáo y học: " Characterization of a new 5'''''''' splice site within the caprine arthritis encephalitis virus genome: evidence for a novel auxiliary protein" pot

Báo cáo y học: " Characterization of a new 5'''' splice site within the caprine arthritis encephalitis virus genome: evidence for a novel auxiliary protein" pot

Báo cáo y học: " Characterization of a new 5'''' splice site within the caprine arthritis encephalitis virus genome: evidence for a novel auxiliary protein" pot

... purposes) Retrovirology Open Access Research Characterization of a new 5' splice site within the caprine arthritis encephalitis virus genome: evidence for a novel auxiliary protein Stephen Valas* 1 , Morgane Rolland 1,2,4 , ... were Mar52 (5'-TAATCTGTGCAATACCAGAGCG- GCT-3'; nt 131 to 155; forward primer) and M3b. Primer pair MarN (5'-CAG...

Ngày tải lên: 13/08/2014, 06:20

17 423 0
Báo cáo y học: "Mutagenesis of tyrosine and di-leucine motifs in the HIV-1 envelope cytoplasmic domain results in a loss of Env-mediated fusion and infectivi" pps

Báo cáo y học: "Mutagenesis of tyrosine and di-leucine motifs in the HIV-1 envelope cytoplasmic domain results in a loss of Env-mediated fusion and infectivi" pps

... 5’CCCCCTGCGTCCCAGAAGTTC- CACA-ATCCTCG3’, Y7 95S/LL799HQ /Y8 02SFP - 5’GG AAGCCCTCAAA- CTTGGTGGAATCACCAACAGTCTTGGAGTCAG- G3’, Y7 95S/LL799HQ /Y8 02SRP - 5’CCTGACTCCAAGAC- TGTTGGTGATTCCACCAAGATTTGAGGGCTTCC3’, LL814AAFP ... 5’CCTGACTCCAAGAC- TGTTGGTGATTCCACCAAGATTTGAGGGCTTCC3’, LL814AAFP - 5’ GC TGTTAACGCGGCCAATGC- CAATGCCACAGC3’, LL814AARP - 5’GGCAT TGGCCGCGT TAACAGC- ACTATTC3’, LL855AAFP - 5...

Ngày tải lên: 13/08/2014, 01:20

17 362 0
Báo cáo y học: "Characterization of a new simian immunodeficiency virus strain in a naturally infected Pan troglodytes troglodytes " ppt

Báo cáo y học: "Characterization of a new simian immunodeficiency virus strain in a naturally infected Pan troglodytes troglodytes " ppt

... sanctuary in Cameroon, in November 2003 at approximately 1.5 years old. The animal was confiscated by the Ministry of Environment and Forestry near the Dja F aunal Reserve in south-central Cameroon, ... and 2009. The hypervariable loops V1, V2, V3 and V4 are analyzed. The alignment consensus of all clonal sequences is indicated at the top. The dots stand for gaps, dashes...

Ngày tải lên: 13/08/2014, 01:20

13 337 0
Tài liệu Báo cáo Y học: Characterization of a cloned subtilisin-like serine proteinase from a psychrotrophic Vibrio species doc

Tài liệu Báo cáo Y học: Characterization of a cloned subtilisin-like serine proteinase from a psychrotrophic Vibrio species doc

... 17448–17453. 18. Feller, G., Payan, F., Theys, F., Qian, M., Haser, R. & Gerday, C. (1994) Stability and structural analysis of a- amylase from the antarctic psychrophile Alteromonas haloplanctis. Eur. J. ... 5¢-ATGTTAAA GAAAGTATTAAGTTGTTG-TATTGCAGC-3¢ and 5¢-AAAGTTTGCTTGGAGCGTCAAGCC-ACTGTAAG CCG-3¢, cloned into the expression vector pBAD-TOPO, transformed into the E.coliTop10 st...

Ngày tải lên: 21/02/2014, 01:21

11 551 0
Tài liệu Báo cáo Y học: Characterization of a novel silkworm (Bombyx mori ) phenol UDP-glucosyltransferase potx

Tài liệu Báo cáo Y học: Characterization of a novel silkworm (Bombyx mori ) phenol UDP-glucosyltransferase potx

... UDP- glycosyltransferase. The UDP-glycosyltransferases ( UGTs) are a superfamily of enzymes that p lay a central role in the detoxication and elimination of a wide range of endogenous and exogenous compounds. ... project. A wing disc cDNA library derived from fifth instar B. mori C108 larvae was kindly provided by Dr Kawasaki (University of Utsunomiya, Japan). A total of...

Ngày tải lên: 22/02/2014, 04:20

7 471 0
Báo cáo Y học: Characterization of a low redox potential laccase from the basidiomycete C30 pptx

Báo cáo Y học: Characterization of a low redox potential laccase from the basidiomycete C30 pptx

... fungi, insects and bacteria [1]. In plants, they may mainly play a role in lignification [4] whereas in fungi they probably play the opposite role, i.e. delignifica- tion [5,6], among many others [1]. C30 ... (malt extract/Tween 80/ Cu/p-hydroxybenzoate) [15]. The fungus was cultivated at 30 °C on a reciprocal shaker (50 r.p.m.) for 5 days [15]. Laccase activity The routine assay f...

Ngày tải lên: 08/03/2014, 09:20

7 617 0
Báo cáo Y học: Characterization of a partially folded intermediate of stem bromelain at low pH ppt

Báo cáo Y học: Characterization of a partially folded intermediate of stem bromelain at low pH ppt

... state, has been localized at pH 5.0 for the apo -a- lactalbumin by Lala & Kaul [46] and between pH 3.7 and 4.0 for Ca 2+ -saturated bovine a- lactalbumin by Gussakovsky & Haas [47]. ACKNOWLEDGEMENT Facilities ... Ananas comosus has been made till date. A rroyo-Reyna et al. have proposed that bromelain f orms may have t he same folding pattern shown by other members of the...

Ngày tải lên: 24/03/2014, 00:21

6 495 0
Báo cáo Y học: Characterization of a Saccharomyces cerevisiae NADP(H)-dependent alcohol dehydrogenase (ADHVII), a member of the cinnamyl alcohol dehydrogenase family pptx

Báo cáo Y học: Characterization of a Saccharomyces cerevisiae NADP(H)-dependent alcohol dehydrogenase (ADHVII), a member of the cinnamyl alcohol dehydrogenase family pptx

... properties. ADHVI and ADHVII are the only members of the cinnamyl alcohol dehydrogenase family in yeast. Simultaneous deletion of ADH6 and ADH7 was not lethal for the yeast. Both enzymes could participate ... cinnamyl alcohol dehydrogenase family Carol Larroy, Xavier Pare ´ s and Josep A. Biosca Department of Biochemistry and Molecular Biology, Universitat Auto ` noma de Barcel...

Ngày tải lên: 31/03/2014, 08:20

8 379 0
Báo cáo Y học: Characterization of selenoprotein P as a selenium supply protein docx

Báo cáo Y học: Characterization of selenoprotein P as a selenium supply protein docx

... Se applied to the column [37]. The SeP in the plasma of Chinese men of varying Se status accounted for 50–60% of the total Se in their plasma [38]. In another approach based on immunoassay, 40–44% ... Tokyo, Japan. Other chemicals were of the highest quality commercially available. Preparation of SeP- and eGPx-depleted human serum Six monoclonal antibodies (BD1, BD3, BF2...

Ngày tải lên: 31/03/2014, 08:20

6 371 0
Báo cáo Y học: Characterization of heparin binding by a peptide from amyloid P component using capillary electrophoresis, surface plasmon resonance and isothermal titration calorimetry ppt

Báo cáo Y học: Characterization of heparin binding by a peptide from amyloid P component using capillary electrophoresis, surface plasmon resonance and isothermal titration calorimetry ppt

... A measurement of the distance between the Lys and Arg in AP-1 shows that they are  27 A ˚ apart while the same residues are separated by 11 A ˚ in the random conforma- tion of the scrambled ... to tetra- saccharide, hexasaccharide, octasaccharide, decasaccharide, dodecasaccharide and tetradecasaccharide, and DUA is 4-deoxy -a- L -threo-hexenopyranosyluronic acid), were p...

Ngày tải lên: 31/03/2014, 23:20

8 348 0
Từ khóa:
w