Báo cáo y học: "RNA interference: a multifaceted innate antiviral defense Ajit Kumar" ppsx

Báo cáo y học: "RNA interference: a multifaceted innate antiviral defense Ajit Kumar" ppsx

Báo cáo y học: "RNA interference: a multifaceted innate antiviral defense Ajit Kumar" ppsx

... BioMed Central Page 1 of 4 (page number not for citation purposes) Retrovirology Open Access Commentary RNA interference: a multifaceted innate antiviral defense Ajit Kumar Address: Department of ... Importantly, Wu et al., [35] argue that a given miRNA hairpin may generate more than one product. Therefore, the designation of a particular sequence for a given miRNA may not...
Ngày tải lên : 13/08/2014, 06:20
  • 4
  • 268
  • 0
Báo cáo y học: "RNA interference: more than a research tool in the vertebrates'''' adaptive immunity" ppsx

Báo cáo y học: "RNA interference: more than a research tool in the vertebrates'''' adaptive immunity" ppsx

... complexity and the dynamic interplay of cellular regulation. As plants and invertebrates lack the protein-based adaptive immunity that are found in jawed vertebrates, the ability of RNA silencing ... Medical Research and Public Health, Melbourne, Australia and 2 Department of Biochemistry and Molecular Biology, Monash University, Clayton, Australia Email: Johnson Mak* - mak@burnet.edu.au *...
Ngày tải lên : 13/08/2014, 09:21
  • 4
  • 244
  • 0
Báo cáo y học: "RNA interference has a role in regulating Drosophila telomeres" potx

Báo cáo y học: "RNA interference has a role in regulating Drosophila telomeres" potx

... telomerase TTAGGG TT[T /A] GGG TTAGG Human Tomato Silk moth HeT -A TA RT Ta hre (A) n gag 3’ UTR Approximately 6 kb Approximately 12 kb Approximately 10 kb (A) n gag pol 3’ UTR 5’ UTR 5’ UTR (A) n gag pol 3’ UTR5’ UTR (b) (a) evidence ... study was HeT -A, a transposable element dedicated to telomere maintenance in Drosophila, not a parasitic invader. Savitsky and colleagues [2]...
Ngày tải lên : 14/08/2014, 16:21
  • 5
  • 223
  • 0
Báo cáo y học: "RNA interference of argininosuccinate synthetase restores sensitivity to recombinant arginine deiminase (rADI) in resistant cancer cells" pps

Báo cáo y học: "RNA interference of argininosuccinate synthetase restores sensitivity to recombinant arginine deiminase (rADI) in resistant cancer cells" pps

... siRNA (ASsiRNA) and negative control (NCsiRNA) were 5’ GCUAUGACGUCAUUGCCU Att 3’ (sense), 5’ UAGGCAAUGACGUCAUAGCtt 3’ (anti- sense) and 5’ GUUUGACUCUCCAAACGGUtt 3’ (sense), 5’ ACCGUUUGGAGAGUCAAACtt ... Medicine, National Taiwan University, Taipei, Taiwan. 3 Department of Pharmacy, National Taiwan University Hospital, Taipei, Taiwan. 4 National Center of Excellence for Clinical Trial and Resea...
Ngày tải lên : 10/08/2014, 05:21
  • 11
  • 313
  • 0
Báo cáo y học: "RNA interference against polo-like kinase-1 in advanced non-small cell lung cancers" doc

Báo cáo y học: "RNA interference against polo-like kinase-1 in advanced non-small cell lung cancers" doc

... 61:850-862. 14. Ochiya T, Takahama Y, Nagahara S, Sumita Y, Hisada A, Itoh H, Nagai Y, Terada M: New delivery system for plasmid DNA in vivo using atelocollagen as a carrier material: the Minipellet. Nat Med 1999, 5:707-710. 15. Song ... liver metastases of lung cancer. Mol Cancer Ther 2008, 7:2904-2912. 52. Nogawa M, Yuasa T, Kimura S, Tanaka M, Kuroda J, Sato K, Yokota A, Segawa H,...
Ngày tải lên : 10/08/2014, 09:22
  • 6
  • 322
  • 0
Báo cáo y học: "RNA interference for CFTR attenuates lung fluid absorption at birth in rats" doc

Báo cáo y học: "RNA interference for CFTR attenuates lung fluid absorption at birth in rats" doc

... 5'- GATCCGTTACACTATTAACAACAAATTCAAGAGATTT- GTTGTTAATAGTGTAATTT TTTGGAAA-3', pSi-4, reverse: 5-AGCTTTTCCAAAAAATTACACTAT- TAACAACAAATCTCTTGAATTTGTTGTTAATAG TGTAACG-3'. We also used the same negative control, pSi-0. Respiratory ... 5'- GCTTTTCCAAAAAATGGAGAGATGAAGAAATAT- TCTCTTGAAATATTTCTTCATCTCTCCACG-3'; pSi-C 2 , forward 5'- ATCCGAAAGTATATGTACCAAGATTCAAGAGATCTTGG-...
Ngày tải lên : 12/08/2014, 15:21
  • 12
  • 212
  • 0
Báo cáo y học: "RNA interference pinpoints regulators of cell size and the cell cycle" doc

Báo cáo y học: "RNA interference pinpoints regulators of cell size and the cell cycle" doc

... scale. For example, the data generated can be analyzed and presented in various ways to highlight the different phenotypic effects (see the supplementary data accompanying [9]). The Taipale lab ... the data manually, Bjorklund et al. [9] found that dsRNA-mediated RNAi against eight other components of the insulin/Tor pathway gave weak but detectable pheno- types. Surprisingly though, they ......
Ngày tải lên : 14/08/2014, 16:21
  • 3
  • 197
  • 0
Báo cáo y học: "RNA interference is not involved in natural antisense mediated regulation of gene expression in mammals" docx

Báo cáo y học: "RNA interference is not involved in natural antisense mediated regulation of gene expression in mammals" docx

... 2003, 21:379-386. 4. Katayama S, Tomaru Y, Kasukawa T, Waki K, Nakanishi M, Nakamura M, Nishida H, Yap CC, Suzuki M, Kawai J, et al.: Antisense tran- scription in the mammalian transcriptome. Science ... 2005, 309:1564-1566. 5. Carninci P, Kasukawa T, Katayama S, Gough J, Frith MC, Maeda N, Oyama R, Ravasi T, Lenhard B, Wells C, et al.: The transcriptional landscape of the mammalian genome....
Ngày tải lên : 14/08/2014, 16:21
  • 9
  • 320
  • 0
Báo cáo y học: "Intramuscular Olanzapine – a UK case series of early cases" ppsx

Báo cáo y học: "Intramuscular Olanzapine – a UK case series of early cases" ppsx

... injections of olanzapine, lorazepam or placebo in treating acutely agi- tated patients diagnosed with bipolar mania. J Clin Psychophar- macology 2001, 21:389-397. 9. Kay SR, Sevy S: Pyramidical model ... bushe_chris@lilly.com; Mark Taylor - Mark.Taylor@glacomen.scot.nhs.uk; Mathew Mathew - mathew@vmmathew.fsnet.co.uk * Corresponding author Abstract Background: Clinical trials assessing effi...
Ngày tải lên : 08/08/2014, 21:20
  • 5
  • 616
  • 0
Báo cáo y học: "Bacterial flagellin elicits widespread innate immune defense mechanisms, apoptotic signaling, and a sepsis-like systemic inflammatory response in mice" ppsx

Báo cáo y học: "Bacterial flagellin elicits widespread innate immune defense mechanisms, apoptotic signaling, and a sepsis-like systemic inflammatory response in mice" ppsx

... commercially available ELISA kits (R&D Systems, Minneapolis, MN, USA) according to m anufacturer’sprotocol.Thesame cytokines were also measured in plasma. Presentation of data and statistical analysis All ... FG, Szabo C, Salzman AL: Flagellin, a novel mediator of Salmonella-induced epithelial activation and systemic inflammation: I kappa B alpha degradation, induction of nitric oxide s...
Ngày tải lên : 13/08/2014, 21:21
  • 11
  • 210
  • 0