Báo cáo y học: " Human T Lymphotropic Virus Type 1 protein Tax reduces histone levels" pot

Báo cáo y học: " Human T Lymphotropic Virus Type 1 protein Tax reduces histone levels" pot

Báo cáo y học: " Human T Lymphotropic Virus Type 1 protein Tax reduces histone levels" pot

... AAGGAGCGCAATGGCCTTTCTTTG; H1 Rev GCCTTCTTGGCCTTTGCAGCTTTA; H2A Fwd TTCAGTTTCCCGTAGGCCGAGT, H2A Rev GA AGCTTGTTGAGCTCCTCATCGT; H2B Fwd AAGAAGGATGGCAAGAAGCGCAAG; H2B Rev ACTTGGAGCTGGTGTACTTGGTGA; H3 ... GTTTGAGAACACCAGTCTCCACTC; Tax Fwd TTCTACCCGAAGACTGTTTGCCCA; Tax Rev TGTCCAAATAAGGCCTGGAGTGGT. Histone content relative to DNA content determination by flow cytometry Asynchronous cells (5...

Ngày tải lên: 13/08/2014, 06:20

14 269 0
Báo cáo y học: " Human T-lymphotropic virus type-1 p30 alters cell cycle G2 regulation of T lymphocytes to enhance cell survival" pptx

Báo cáo y học: " Human T-lymphotropic virus type-1 p30 alters cell cycle G2 regulation of T lymphocytes to enhance cell survival" pptx

... rabbit polyclonal anti- PLK1pT 210 # 600-4 01- 466 (1: 10 00, Rockland, Gilberts- ville, PA), polyclonal rabbit anti-Cdc2 T- 16 1 # 911 4 (1: 1000, Cell Signaling), polyclonal rabbit anti Cdc2 Y- 15 # 911 1 (1: 1000, ... proteins in HTLV -1 in both disease patients and asymptomatic subjects. Freshly cultured transformed lymphocytes from HTLV -1 patients express both Tax and p30 [15...

Ngày tải lên: 13/08/2014, 05:22

15 171 0
Báo cáo y học: " Human T lymphotropic virus type-1 p30II alters cellular gene expression to selectively enhance signaling pathways that activate T lymphocytes" doc

Báo cáo y học: " Human T lymphotropic virus type-1 p30II alters cellular gene expression to selectively enhance signaling pathways that activate T lymphocytes" doc

... Yamasaki Y, Yamada Y, Tomonaga M, Mori- kawa S, Geleziunas R, Yoshimura T, Yamamoto N: Human T- cell leukemia virus type I tax activates transcription of the human monocyte chemoattractant protein -1 ... co-stimulator treatments (C). Retrovirology 2004, 1: 39 http://www.retrovirology.com/content /1/ 1/39 Page 2 of 12 (page number not for citation purposes) Background Huma...

Ngày tải lên: 13/08/2014, 13:20

12 487 0
Báo cáo y học: "Subacute herpes simplex virus type 1 encephalitis as an initial presentation of chronic lymphocytic leukemia and multiple sclerosis: a case report" doc

Báo cáo y học: "Subacute herpes simplex virus type 1 encephalitis as an initial presentation of chronic lymphocytic leukemia and multiple sclerosis: a case report" doc

... received treatment for herpes simplex virus type 1 encephalitis raises the possibility that herpes simplex virus type 1 encephalitis in patients who are immunosuppressed may trigger multiple sclerosis. Introduction Herpes ... primary infection, or in patients over the age of 50 years due to rea ctivation of latent infection. It is thought to occur sporadically in patients who are...

Ngày tải lên: 11/08/2014, 00:22

7 403 0
Báo cáo y học: "Human T-cell leukemia virus type 2 post-transcriptional control protein p28 is required for viral infectivity and persistence in vivo" ppt

Báo cáo y học: "Human T-cell leukemia virus type 2 post-transcriptional control protein p28 is required for viral infectivity and persistence in vivo" ppt

... modulating activity, suggesting potentially divergent functions that may be responsible for the distinct pathobiologies of HTLV -1 and HTLV-2. Results: In this study, we investigated the functional ... possible that p28 may have multiple activities that function at different stages of the infection process. Future experiments designed to quantitatively assess viral infectivity of rabbits at...

Ngày tải lên: 13/08/2014, 05:20

11 278 0
Báo cáo y học: "Human T-cell leukemia virus type I infects human lung epithelial cells and induces gene expression of cytokines, chemokines and cell adhesion molecules" ppt

Báo cáo y học: "Human T-cell leukemia virus type I infects human lung epithelial cells and induces gene expression of cytokines, chemokines and cell adhesion molecules" ppt

... Yamada Y, Tomonaga M, Mori- kawa S, Geleziunas R, Yoshimura T, Yamamoto N: Human T- cell leukemia virus type I Tax activates transcription of the human monocyte chemoattractant protein -1 gene through two ... (TGF- 1) gene by human T lymphotropic virus type 1 tax: a potential mechanism for the increased production of TGF- 1 in adult T cell leukemia. J Exp Med...

Ngày tải lên: 13/08/2014, 05:21

10 215 0
Báo cáo y học: " Human T-cell leukemia virus type 2 Tax protein induces interleukin 2-independent growth in a T-cell line" ppt

Báo cáo y học: " Human T-cell leukemia virus type 2 Tax protein induces interleukin 2-independent growth in a T-cell line" ppt

... glyceraldehyde-3-phosphate dehydrogenase gene used as a control, 5'-TGTGTCCGTCGT- GGATCTGA-3' and 5'-TTGCTGTTGAAGTCGCAGGAG-3'. 0.00 01 0.0 01 0. 01 0 .1 1 10 EL-4 EL-4 Tax1 -2 Tax1 -6 Tax2 -3 Tax2 -6 Tax2 -7 Tax2 -8 PMA+Iono + ࡯ Relative ... (Figure 1) . A Western blotting analysis using Tax1 and Tax2 antibodies showed that all four Tax2 -trans- formed cel...

Ngày tải lên: 13/08/2014, 09:20

7 239 0
Báo cáo y học: "Human T-cell leukemia virus type I (HTLV-I) infection and the onset of adult T-cell leukemia (ATL)" pps

Báo cáo y học: "Human T-cell leukemia virus type I (HTLV-I) infection and the onset of adult T-cell leukemia (ATL)" pps

... counteracts its inhibitory activity towards CDK4. Embo J 19 96, 15 :16 07 -16 14. 30. Jin DY, Spencer F, Jeang KT: Human T cell leukemia virus type 1 oncoprotein Tax targets the human mitotic checkpoint ... Nevertheless, these data suggest that potentiation of the immune response against viral proteins such as Tax may be an attractive way to treat ATL patients [94]. Such str...

Ngày tải lên: 13/08/2014, 09:21

13 745 0
Báo cáo y học: " Prevalence of GB virus type C in urban Americans infected with human immunodeficiency virus type 1" ppsx

Báo cáo y học: " Prevalence of GB virus type C in urban Americans infected with human immunodeficiency virus type 1" ppsx

... necessary in HIV -1- infected patients to clarify the potential effects of GBV-C co-infection. Our data support the hypothesis that GBV-C viremic patients with HIV -1 respond better to therapy, which ... adequate data on the duration of HIV -1 infection and the possible impact of antiretroviral therapy in these patients. The latter restriction may be balanced by the fact that nearly all HI...

Ngày tải lên: 13/08/2014, 09:21

5 388 0
Báo cáo y học: "Human autoantibodies against the 54 kDa protein of the signal recognition particle block function at multiple stages" ppt

Báo cáo y học: "Human autoantibodies against the 54 kDa protein of the signal recognition particle block function at multiple stages" ppt

... found that the IgG fractions from polymyositis patients containing anti-SRP54 autoantibodies (sera 17 -1, 19 -1, 25 -1, 4-2), but not from polymyositis patients without myositis autoantibodies or with ... control or from polymyositis patients containing either no detectable myositis autoantibodies (serum 5 15 ) or with anti-Jo -1 autoantibodies directed against histidyl-tRNA synthetase (se...

Ngày tải lên: 09/08/2014, 07:20

13 261 0
w