Báo cáo y học: "Expression of infectious murine leukemia viruses by RAW264 7 cells, a potential complication for studies with a widely used mouse macrophage cell line" ppsx
Báo cáo y học: "Expression of infectious murine leukemia viruses by RAW264.7 cells, a potential complication for studies with a widely used mouse macrophage cell line" ppsx
... of RAW264. 7 cells or 264 .7 SC-1, a harvest of SC-1 cells infected with RAW264. 7 supernatant and passaged twice. For comparison, mice were similarly MuLV p30 expressed by RAW264. 7 cells in a formalin-fixed, ... stud- ied by IHC using the anti-p30 antibody, anti-CD3 for T- cell lineage identification (DAKO Corporation, Carpinte- ria, CA Catalog # A4 52), and a...
Ngày tải lên: 13/08/2014, 06:20
Báo cáo Y học: Expression of recombinant murine pregnancy-associated plasma protein-A (PAPP-A) and a novel variant (PAPP-Ai) with differential proteolytic activity pot
... separating layers. Thus, most likely, the synthesis of PAPP -A does not correlate with placental type. The detected PAPP -A mRNA of the murine placenta may originate from cells of fetal or maternal ... previously that the apparently constant level of intact IGFBP-4 in murine pregnancy was caused by an increase in synthesis along with increased proteolysis. The presence of...
Ngày tải lên: 31/03/2014, 21:21
Báo cáo y học: "Expression of tumor necrosis factor-alpha converting enzyme and matrix metalloproteinase-3 in proliferated synovium in a patient with synovitis-acne-pustulosis-hyperostosis-osteitis syndrome: a case report" doc
... Toyoake, Aichi, Japan 3 Department of Pathology, Fujita Health University, 1-98 Dengakugakubo, Kutsukake, Toyoake, Aichi, Japan Email: KK* - komiya@qb3.so-net.ne.jp; HY - hayamada@fujita-hu.ac.jp; ... infliximab: report of two cases. Ann Rheum Dis 2002, 61: 375 - 376 . 5. Massara A, Cavazzini PL, Trotta F: In SAPHO syndrome anti- TNF-alpha therapy may induce persistent amelioration of...
Ngày tải lên: 11/08/2014, 14:21
Báo cáo y học: "Expression of Human Globular Adiponectin-Glucagon-Like Peptide-1 Analog Fusion Protein and Its Assay of Glucose-Lowering Effect In Vivo"
... Statistical analysis Data were expressed as means ± standard devi- ations. Data were analyzed using one-way analysis of variance and secondary analysis for significance with the Turkey-Kramer ... Enterokinase cleavage of the N-terminal His-tagged gAd-GLP-1 -A fusion protein. (A) SDS-PAGE analysis: After enterokinase cleavage, we observed a cleavage fragment of 22KD. The fr...
Ngày tải lên: 25/10/2012, 11:10
Báo cáo y học: "Expression of hMSH2 protein of the human DNA mismatch repair system in oral lichen planus"
... is characterized by a sub-epithelial lymphocytic infiltrate, disruption of epithelial basement membrane, degeneration of basal keratinocytes, hyperkeratinization and acanthosis [24]. Basal cells ... non-immunized rabbit serum instead of the primary antibody. Cell quantification and Statistical analysis The immunolocalization of hMSH2 was quantitatively analyzed. Epithelial ce...
Ngày tải lên: 03/11/2012, 09:54
Báo cáo Y học: Expression of the V-ATPase proteolipid subunit of Acetabularia acetabulum in a VMA3-deficient strain of Saccharomyces cerevisiae and study of its complementation pdf
... case of AACEVAPD1, 3 and 6, TAA is used as an Acetabularia-specific codon usage (translated as Gln). Conversion of TAA to CAA was performed by PCR as described below. AACEVAPD1 has two TAA codons ... Umami 1 , Yuki Taguro 1 , Yoshio Okada 1 ,YohWada 2 , Yoichi Nakanishi 3 and Masayoshi Maeshima 3 1 Department of Nutritional Science, Faculty of Health and Welfare Science, Okayama Pr...
Ngày tải lên: 08/03/2014, 23:20
Báo cáo Y học: Expression of uncoupling protein-3 in subsarcolemmal and intermyofibrillar mitochondria of various mouse muscle types and its modulation by fasting docx
... the CabrX antibody with mouse recombinant UCP3 was also demonstrated. The signals can be quantitated and compared with a reasonable degree of accuracy, but only if obtained on the same gel. The ... similar uncoupling activities [2]. In fact, using heterologous yeast and mammalian cell expression systems, UCP3 was shown to decrease the mitochondrial membrane potential, as measure...
Ngày tải lên: 24/03/2014, 04:21
Báo cáo Y học: Expression of the aspartate/glutamate mitochondrial carriers aralar1 and citrin during development and in adult rat tissues docx
... exchange of aspartate for glutamate and plays an important role in the malate/aspartate shuttle, urea synthesis and gluconeogenesis from lactate [13–15]. These two AGC isoforms are activated by Ca 2+ on ... and 7 (SLC2 5A1 3 [8,11]), respectively. As recently demonstrated, aralar1 and citrin are isoforms of the mitochondrial aspartate/glutamate carrier (AGC) [12] which catalyzes a...
Ngày tải lên: 24/03/2014, 04:21
Báo cáo Y học: Expression of glucose transporter-2, glucokinase and mitochondrial glycerolphosphate dehydrogenase in pancreatic islets during rat ontogenesis potx
... change in A 412 before the addition of oxalacetate (which is acetyl-CoA hydrolase activity) from the change in A 412 after addition of oxalace- tate. Succinate dehydrogenase activity [18] was ... in the immature secre- tory responses of fetal rat pancreatic islets. Diabetologia 37, 134±140. 27. Oka, Y. , Asano, T., Shibsak i, Y. , Lin, J.L., Tsukuda, K ., Akamuna, Y. & Taka...
Ngày tải lên: 31/03/2014, 15:20
Báo cáo Y học: Expression of the uncoupling protein 1 from the aP2 gene promoter stimulates mitochondrial biogenesis in unilocular adipocytes in vivo potx
... (5¢)3¢) Antisense primer (5¢)3¢) GenBank acc. no. COX IV a AGAAGGCGCTGAAGGAGAAGGA CCAGCATGCCGAGGGAGTGA NM_009941 NRF-1 ATGGGCCAATGTCCGCAGTGATGTC GGTGGCCTCTGATGCTTGCGTCGTCT AF098 077 b-actin GAACCCTAAGGCCAACCGTGAAAAGAT ... cells for each animal was measured by an Image Analyzer KS100 IBAS Kontron ( Karl Zeiss Jena, Germany), in o rder to calculate the diameter of the adipocytes. In th...
Ngày tải lên: 31/03/2014, 15:20