Báo cáo y học: " Rapid spread of mouse mammary tumor virus in cultured human breast cells" pot

... reproduction in any medium, provided the original work is properly cited. Plasmodium duplicate gene expression<p> ;Duplicated var2csa genes in one strain of Plasmodium falciparum are simultaneously ... between highly similar gene copies in P. falciparum parasites. The duplicated var2csa variants are simultaneously transcribed, both on a population level and i...

Ngày tải lên: 09/08/2014, 20:20

... 1 of 9 (page number not for citation purposes) Journal of Circadian Rhythms Open Access Research Altered expression of circadian clock gene, mPer1, in mouse brain and kidney under morphine dependence ... mPER1 protein expressed in the brains and kidneys of Con, MD and MW miceFigure 4 Circadian variation of mPER1 protein expressed in the brains...

Ngày tải lên: 10/08/2014, 09:20

... limitation of video recording during darkness by using a camera that, by automatically switch- ing to infrared in complete darkness, allowed us to contin- uously monitor activity during the light and ... the amount of overall Activity of a rat in L:D and D:D conditionsFigure 6 Activity of a rat in L:D and D:D conditions. Top: 3rd day in LD conditions ; bottom: 5th day u...

Ngày tải lên: 10/08/2014, 09:20

... where serratus anterior function was signifi- cantly improved within 24 hours of surgery for long tho- racic nerve neuropathy. Methods Patients Microneurolysis of the long thoracic nerve was performed 107 ... trunk, typically 15%–20% of the thickness of the muscle. A demarcated area of compression was typically apparent toward the point of exit of the long...

Ngày tải lên: 10/08/2014, 09:22

... substantial apoptotic tumor cells for DC loading. Because both activated mono- cytes and apoptotic malignant T cells are obtained indi- vidually and can be re-added after treatment, the optimal conditions ... essentially as described by the manufacturer. Statistical evaluation The expression of DC markers and the MLC response was evaluated statistically by the student's...

Ngày tải lên: 11/08/2014, 10:23

... B. anthracis spores and suggest parallel treatment with anti- biotics can significantly enhance survival. Many groups have shown the efficacy of polyclonal, ani- mal-derived sera for use as a passive ... 1 Wadsworth Center, New York State Department of Health, Biodefense Laboratory, Albany, NY, USA, 2 SUNY at Albany, School of Public Health, Department of Biomedical Sciences, Alb...

Ngày tải lên: 11/08/2014, 10:23

... this article as: Zhao et al.: Rapid detection of porcine circovirus type 2 using a TaqMan-based real-time PCR. Virology Journal 20 10 7:374. Submit your next manuscript to BioMed Central and take ... 7:374 http://www.virologyj.com/content/7/1/374 Page 5 of 5 SHOR T REPOR T Open Access Rapid detection of porcine circovirus type 2 using a TaqMan-base...

Ngày tải lên: 11/08/2014, 21:21

... 8:38 http://www.virologyj.com/content/8/1/38 Page 7 of 7 MET H O D O LO G Y Open Access Rapid isolation of mycoviral double-stranded RNA from Botrytis cinerea and Saccharomyces cerevisiae Antonio ... characterization. ThemethodallowsgettinghighqualitydsRNA,freeof DNA and ssRNA, and it can be applied to isolate dsRNA from a ny type of fungus or any biological...

Ngày tải lên: 11/08/2014, 21:21

... Central Page 1 of 3 (page number not for citation purposes) Journal of Medical Case Reports Open Access Case report Direct spread of thyroid follicular carcinoma to the parotid gland and the internal ... unusual metastasis of a thyroid follicular carcinoma including the histopathological and radiological findings. A woman was seen in the oto...

Ngày tải lên: 11/08/2014, 21:22

... Access Different regulation of cigarette smoke induced inflammation in upper versus lower airways Wouter Huvenne 1* , Claudina A Pérez-Novo 1 , Lara Derycke 1 , Natalie De Ruyck 1 , Olga Krysko 1 , ... effects of CS o n upper airways, especially in comparison to the lower airways. We therefore aimed to investigate the inflammatory response of the upper airway...

Ngày tải lên: 12/08/2014, 11:22

... development of acute hyperoxic lung injury within a few days. Upon hyperoxic exposure, the inducible nitric oxide synthase (iNOS) is activated by a variety of proinflammatory cytokines both in vitro ... citation purposes) Respiratory Research Open Access Research Proinflammatory role of inducible nitric oxide synthase in acute hyperoxic lung injur...

Ngày tải lên: 12/08/2014, 18:21

... (CTGCCCT- GTATCATCTGAACC) and T3R3 4a (CTCCCCTGAC ATT CAACGC) amplifying the gag gene of the viral genome whereas for the murine hybrid retrovirus primers T3R27s2 (CAGGGAGAACATGGTAATAGGA) and T3R2 7a2 (ACGACCTCTCCAAAGTATCCA) ... Interna- tional Journal of Cancer 1974, 13 :24 6 -25 3. 14. Popovic M, Kalyanaraman VS, Reitz MS, Sarngadharan MG: Identifi- cation of the Rpmi- 822 6 Retrovi...

Ngày tải lên: 12/08/2014, 23:22

... associated with an accumu- lation of these same cells in infected lymphatic tissues, suggesting that Tregs either redistribute to infected tissues, proliferate there, or both [36,55]. Tregs at the ... ‘helper’ T( Th)cells,sinceCD4 + T- cell help is required for both the induction of neutralizing antibodies by mature B cells and for the maintenance of effective cytotoxic T...

Ngày tải lên: 13/08/2014, 01:21

... MMTV infection. Results: Here, we show for the first time the rapid spread of mouse mammary tumor virus, MMTV(GR), in cultured human mammary cells (Hs578T), ultimately leading to the infection of every ... the identification of such factors remains often elusive. The involvement of mouse mammary tumor virus (MMTV), known to be associated with mammary carc...

Ngày tải lên: 13/08/2014, 05:22

... we determined that the vast majority of amino acid substitutions could be explained by single non-synonymous nucleotide changes. Inspection of the types of amino acid substitutions in repeats ... deeper insight into the substitution patterns in repeats and adjacent regions can be obtained by the analysis of the types of amino acid substitutions, as we...

Ngày tải lên: 14/08/2014, 16:21