Báo cáo y học: " Rapid spread of mouse mammary tumor virus in cultured human breast cells" pot
Báo cáo y học: "Simultaneous transcription of duplicated var2csa gene copies in individual Plasmodium falciparum parasites" potx
... reproduction in any medium, provided the original work is properly cited. Plasmodium duplicate gene expression<p> ;Duplicated var2csa genes in one strain of Plasmodium falciparum are simultaneously ... between highly similar gene copies in P. falciparum parasites.The duplicated var2csa variants are simultaneously transcribed, both on a population level andintriguingly also in individual cells, ... transcribed in individual parasites collected at24 ± 4 h post-invasion (p.i.; Figure 5a). Transcription of bothallele types was readily detected in the majority of cells ana-lyzed, independent of the...
- 16
- 239
- 0
Báo cáo y học: "Altered expression of circadian clock gene, mPer1, in mouse brain and kidney under morphine dependence and withdrawal" pps
... 1 of 9(page number not for citation purposes)Journal of Circadian RhythmsOpen AccessResearchAltered expression of circadian clock gene, mPer1, in mouse brain and kidney under morphine dependence ... mPER1 protein expressed in the brains and kidneys of Con, MD and MW miceFigure 4 Circadian variation of mPER1 protein expressed in the brains and kidneys of Con, MD and MW mice. The inte-gral ... protein expression in brains and kidneys. a: Positive staining in the nucleus and cytoplasm are found in brains of Con, MD and MW mice. b: Representative cases show positive staining for mPER1 in...
- 9
- 285
- 0
Báo cáo y học: "Altered expression of circadian clock gene, mPer1, in mouse brain and kidney under morphine dependence and withdrawa" docx
... limitation of video recording duringdarkness by using a camera that, by automatically switch-ing to infrared in complete darkness, allowed us to contin-uously monitor activity during the light and ... the amount of overallActivity of a rat in L:D and D:D conditionsFigure 6Activity of a rat in L:D and D:D conditions. Top: 3rd day in LD conditions ; bottom: 5th day under free-running, DD con-ditions ... locomotor activity is a valuable tool foranalysing factors influencing behaviour and for investigat-ing brain function. As a result, assessment of locomotoractivity has been used in many fields such...
- 10
- 311
- 0
Báo cáo y học: "Rapid recovery of serratus anterior muscle function after microneurolysis of long thoracic nerve injury" pot
... where serratus anterior function was signifi-cantly improved within 24 hours of surgery for long tho-racic nerve neuropathy.MethodsPatients Microneurolysis of the long thoracic nerve was performed107 ... trunk,typically 15%–20% of the thickness of the muscle. A demarcated area of compression was typically apparenttoward the point of exit of the long thoracic nerve fromthe middle scalene muscle, ... intervals: (1) after exposure of the long thoracic nerve and prior to decompression and microneurolysis (2) after decompression, microneurolysis and tetanic stimulation of the nerve. Intensities of stimulation...
- 8
- 225
- 0
Báo cáo y học: "Rapid construction of a dendritic cell vaccine through physical perturbation and apoptotic malignant T cell loading" pot
... substantial apoptotic tumor cells for DC loading. Because both activated mono-cytes and apoptotic malignant T cells are obtained indi-vidually and can be re-added after treatment, the optimalconditions ... essentially as describedby the manufacturer.Statistical evaluationThe expression of DC markers and the MLC response wasevaluated statistically by the student's t test or if the datawas ... exogenousmaterial into the class I pathway for presentation to CD8 T cells. Our simple approach to rapid DC vaccine con-struction takes advantage of both physical stimulation and production of apoptotic...
- 16
- 251
- 0
Báo cáo y học: "Rapid generation of an anthrax immunotherapeutic from goats using a novel non-toxic muramyl dipeptide adjuvant." docx
... B.anthracis spores and suggest parallel treatment with anti-biotics can significantly enhance survival.Many groups have shown the efficacy of polyclonal, ani-mal-derived sera for use as a passive ... 1Wadsworth Center, New York State Department of Health, Biodefense Laboratory, Albany, NY, USA, 2SUNY at Albany, School of Public Health, Department of Biomedical Sciences, Albany, NY, USA, ... per year for several years making for a nearly endless source of antisera. Plasmapheresis of three goats generated liters of anti-PA83 serum within a veryshort time frame. Additionally, the goats...
- 8
- 312
- 0
Báo cáo y học: " Rapid detection of porcine circovirus type 2 using a TaqMan-based real-time PCR" doc
... this article as: Zhao et al.: Rapid detection of porcine circovirus type 2 using a TaqMan-based real-time PCR. Virology Journal 20 10 7:374.Submit your next manuscript to BioMed Centraland take ... 7:374http://www.virologyj.com/content/7/1/374Page 5 of 5 SHOR T REPOR T Open Access Rapid detection of porcine circovirus type 2 using a TaqMan-based real-time PCRKai Zhao1,3, Fangting Han4, Yong Zou 2, 3, Lianlong Zhu1,3, ... dTTP, dCTP and dGTP, 1 .25 U DNA polymerase,2mMMgCl 2 (TaKaRa, Dalian, China), 20 0 nM of eachprimer, and different quantities of the plasmid DNAtemplates. Amplifications were programmed as follows:onestepof94°Cfor5min,30cyclesof94°Cfor30s,60°C...
- 5
- 389
- 0
Báo cáo y học: " Rapid isolation of mycoviral double-stranded RNA from Botrytis cinerea and Saccharomyces cerevisiae" pot
... 8:38http://www.virologyj.com/content/8/1/38Page 7 of 7 MET H O D O LO G Y Open Access Rapid isolation of mycoviral double-stranded RNA from Botrytis cinerea and Saccharomyces cerevisiaeAntonio ... characterization.ThemethodallowsgettinghighqualitydsRNA,freeofDNA and ssRNA, and it can be applied to isolatedsRNA from a ny type of fungus or any biological sam-ple that contains dsRNA.MethodsFungal strains and culture conditions Botrytis ... al. Virology Journal 2011, 8:38http://www.virologyj.com/content/8/1/38Page 2 of 7 characterization of dsRNA from Saccharomyces cerevisiae and Botrytis cinerea. All the authors read and approved...
- 7
- 319
- 0
Báo cáo y học: " Direct spread of thyroid follicular carcinoma to the parotid gland and the internal jugular vein: a case report" pot
... CentralPage 1 of 3(page number not for citation purposes)Journal of Medical Case ReportsOpen Access Case report Direct spread of thyroid follicular carcinoma to the parotid gland and the internal ... unusual metastasis of a thyroid follicular carcinoma including the histopathological and radiological findings. A woman was seen in the otolaryngology clinic with a mass at the angle of the left ... internal jugular vein, and fewer cases about metastasis to the parotid gland havebeen separately reported. Our patient has both theseorgans involved by direct spread from a thyroid follicular carcinoma. Case...
- 3
- 298
- 0
Báo cáo y học: " Different regulation of cigarette smoke induced inflammation in upper versus lower airways" pot
... Access Different regulation of cigarette smoke induced inflammation in upper versus lower airwaysWouter Huvenne1*, Claudina A Pérez-Novo1, Lara Derycke1, Natalie De Ruyck1, Olga Krysko1, ... effects of CS o n upper airways, especially in comparison to the lower airways.We therefore aimed to investigate the inflammatoryresponse of the upper airways in a murine model of COPD in comparison ... this article as: Huvenne et al.: Different regulation of cigarette smoke induced inflammation in upper versus lower airways. RespiratoryResearch 2010 11:100.Submit your next manuscript to BioMed...
- 9
- 283
- 0
Báo cáo y học: " Proinflammatory role of inducible nitric oxide synthase in acute hyperoxic lung injury" pot
... development of acute hyperoxic lung injury within a few days. Upon hyperoxic exposure, the inducible nitric oxide synthase (iNOS) isactivated by a variety of proinflammatory cytokines both in vitro ... citation purposes)Respiratory ResearchOpen AccessResearch Proinflammatory role of inducible nitric oxide synthase in acute hyperoxic lung injuryAnne-Karin Hesse1, Martina Dörger1, Christian ... a proinflammatory role in acute hyperoxic lung injury.BackgroundSupplemental oxygen therapy is administered for thetreatment of tissue hypoxia, most commonly in an inten-sive care setting of respiratory...
- 9
- 385
- 0
Báo cáo y học: " Unintended spread of a biosafety level 2 recombinant retrovirus" ppsx
... (CTGCCCT-GTATCATCTGAACC) and T3R3 4a (CTCCCCTGAC ATTCAACGC) amplifying the gag gene of the viral genomewhereas for the murine hybrid retrovirus primers T3R27s2(CAGGGAGAACATGGTAATAGGA) and T3R2 7a2 (ACGACCTCTCCAAAGTATCCA) ... Interna-tional Journal of Cancer 1974, 13 :24 6 -25 3.14. Popovic M, Kalyanaraman VS, Reitz MS, Sarngadharan MG: Identifi-cation of the Rpmi- 822 6 Retrovirus and Its Dissemination As A Significant ... cells and the primersSMRV-1s (GTTGGGAACCCAGGCTAAGCTG) and SMRV-805 7a (GTAGGAGGGGAACCGGCTAC) for SMRV andT3R03s (AGGGGATTTATTGGATACACG), T3R3 2a (CATCGTGACCTGGGAAGC) for the murine retrovirus.PCR...
- 6
- 350
- 0
Báo cáo y học: "Distinct roles of CD4+ T cell subpopulations in retroviral immunity: lessons from the Friend virus mouse model" pptx
... associated with an accumu-lation of these same cells in infected lymphatic tissues,suggesting that Tregs either redistribute to infected tissues,proliferate there, or both [36,55]. Tregs at the ... ‘helper’ T( Th)cells,sinceCD4+ T- cell help is required for both the induction of neutralizingantibodies by mature B cells and for the maintenance of effective cytotoxic T cell (CTL) responses. In the ... CD8+CTLs [39,60-62] thus, prolonging the recovery from acuteFV infection, and allowing the establishment of a chronicinfection. The interplay of different subsets of CD4+ T cells in FV infection...
- 12
- 264
- 0
Báo cáo y học: " Rapid spread of mouse mammary tumor virus in cultured human breast cells" pot
... MMTV infection.Results: Here, we show for the first time the rapid spread of mouse mammary tumor virus, MMTV(GR), in cultured human mammary cells (Hs578T), ultimately leading to the infection of every ... theidentification of such factors remains often elusive.The involvement of mouse mammary tumor virus (MMTV), known to be associated with mammary carcino-mas and T-cell lymphomas in mice, in human pathogen-esis ... sequences in human breast tumors and in a lymphoma of a breast cancer patient. ClinCancer Res 2000, 6:1273-1278.5. Ford CE, Tran D, Deng Y, Ta VT, Rawlinson WD, Lawson JS: Mouse mammary tumor virus- like...
- 15
- 166
- 0
Báo cáo y học: "Mutation patterns of amino acid tandem repeats in the human proteome" ppt
... wedetermined that the vast majority of amino acid substitutionscould be explained by single non-synonymous nucleotidechanges. Inspection of the types of amino acid substitutions in repeats ... deeper insight into the substitution patterns in repeats andadjacent regions can be obtained by the analysis of the types of amino acid substitutions, as well as the frequencies of syn-onymous ... focusing on the eight most common amino acids forming tandem repeats (Table 2). The aim was to identify possible biases in the amino acid substitution patterns inside repeats with respect to the repeats& apos;...
- 10
- 207
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngThơ nôm tứ tuyệt trào phúng hồ xuân hươngTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ