Báo cáo y học: "Impairment of alternative splice sites defining a novel gammaretroviral exon within gag modifies the oncogenic properties of Akv murine leukemia virus" pdf
Báo cáo y học: "Impairment of alternative splice sites defining a novel gammaretroviral exon within gag modifies the oncogenic properties of Akv murine leukemia virus" pdf
... point.SD-env[686]SD’ -gag [2092]SA’ -gag [1856]SA-env[5985]LTRCCAGCGATCTATATAACTGGAAAAATAATAATCCATCATTCAGTGAA GAT AAAGAG GTAGGAACCTCTGATCTATATAACTGGAAAAATAATAATCCTTCCTTCTCTGAG GAT AAAGAG GTAGGAACCTCTGATCTATATAACTGGAAAAATAATAATCCTTCCTTCTCTGAG ... GTAGGAACCTCTGATCTATATAACTGGAAAAATAATAATCCTTCCTTCTCTGAG GAT AAAGGG GAC GAAACCAGCGATCTATATAACTGGAAAAATAATAATCCATCATTCAGTGAA GAT AAAGGG GACGAAA Akv- wt Akv- CD Akv- EH Akv- CDHSD* -gag [2038]LTR209218561810*** ... TTTTCCTCCTCTGATCTATATAACTGGAAAAATAATAATCCTTCCTTCTCTGAG|GATMoloney: TTCTCCTCTTCTGACCTTTACAACTGGAAAAATAATAACCCTTCTTTTTCTGAA|GATFriend: TTTTCCTCCTCTGACCTCTATAACTGGAAAAATAACAACCCCTCTTTCTCCGAG|GACSRS19-6:...
- 19
- 178
- 0
Báo cáo y học: "Distinct signal transduction processes by IL-4 and IL-13 and influences from the Q551R variant of the human IL-4 receptor alpha chain" docx
... I); E37 5A = 5'-TTAGCCGGGCCACAAAGGCC-3' and 5'-TGGAGAT-CAGCAAGACAGTC-3' (StuI); S478P = 5'-CTTACCG-CAGCTTCAGGTAC-3' and 5'-TTTCTGGCTCAGGTTGGGGC-3' (KpnI); ... Arinobu Y, Enomoto T,Kawai M, Sasaki S, Dake Y, Hamasaki N, Sirakawa T, Hopkin JM:Ile50Val variant of IL-4R alpha upregulates IgE synthesis andassociates with atopic asthma. Nat Genet 1998, 19:119-12016. ... IL-4stimulation, STAT3 appears after 15–20 min in nuclei of variant, whereas STAT3 appears immediately in nuclei of wildtype individuals. In the case of IL-13 stimulation, STAT3appears immediately in...
- 11
- 384
- 0
Báo cáo y học: " Cell death upon epigenetic genome methylation: a novel function of methyl-specific deoxyribonucleases" docx
... (5'-GGGggtaccGTGAACAAAAGAGATATACAACTAC-3') andStoMcrBC-rev (5'-GGGgtcgacTTAGATTTTACGATTTTCGCCTTTT-3'), or StoMcrBC2-for (5'-GGGggtaccGTGAGGTTAA-GAAAAAGAGATCTAG-3') and StoMcrBC2-rev ... using the H1-ara(GGTTTCGTTTGATTGGCTGTGGTTTTATACAGTCATTACTGCCCGTAATAGTGTAGGCTGGAGCTGCTTC) and H2-ara-BAD (GGCGTCACACTTTGCTATGCCATAGCATTTTTATCCATAAGATTAGCGGAATTCCGGGGATCCGTCGACC) prim-ers. The ... (5'-GGGgtcgacTTAAACCTCTCCCGAAGAGCAGAGG-3'), TkoMcrBC2-for (5'-GGGggtaccATGAATCAATCAGT-TATAATAGATG-3') and TkoMcrBC2-rev (5'-GGGgtcgac-CTAGTTTATTAGCGAATTTAGATAA-3'), StoMcrBC-for (5'-GGGggtaccGTGAACAAAAGAGATATACAACTAC-3')...
- 22
- 120
- 0
Báo cáo y học: " Impairment of chondrocyte biosynthetic activity by exposure to 3-tesla high-field magnetic resonance imaging is temporar" pptx
... bp), 5'-AAA CAG ATG AAG AGCTGC ATC CAA-3' (forward) and 5'-CAA AGC TCA TGC AGAACA CCA CTT-3' (reverse) [26]; β-actin (520 bp), 5'-TGTGAT GGT GGG AAT GGG TCA G-3' ... suggest a decrease in biosynthetic activity,according to the sGAG synthesis rate, of articular chondro-Figure 3Expression of the cartilage markers aggrecan and collagen type II and also of IL-1βExpression ... inadequate flow of electrolytes and charges that ulti-mately impair cartilage activity. This assumption is fostered byour observations of a marked decrease in anabolic activity, asshown by sGAG...
- 11
- 419
- 0
Báo cáo y học: "Impairment of organ-specific T cell negative selection by diabetes susceptibility genes: genomic analysis by mRNA profiling" pot
... Institute, The Australian National University, Canberra, ACT 2601, Australia. ‡Biochemistry and Molecular Biology, The Australian National University, Canberra, ACT 2601, Australia. § The Australian ... 43 0A arrays(Santa Clara, CA, USA).Microarray data processing The Affymetrix 43 0A chips were scanned using standardAffymetrix protocols. All arrays passed routine quality con-trol assessment ... 291:319-322.81. Ansari MJ, Salama AD, Chitnis T, Smith RN, Yagita H, Akiba H, Yama-zaki T, Azuma M, Iwai H, Khoury SJ, et al.: The programmeddeath-1 (PD-1) pathway regulates autoimmune diabetes innonobese...
- 23
- 221
- 0
Báo cáo y học: "Discriminating between elderly and young using a fractal dimension analysis of centre of pressure"
... towards recognising the chaotic properties of natural phenomena and the use of appropriate non-linear analysis, such as fractal analysis, in place of traditional analyses [1]. A strong reason ... be indicative of a shift towards an unhealthy or less desirable control strategy. The analysis of fractal patterns in gait and posture data may serve as an indicator of pathology or impairment. ... assess the variability of gait data in the elderly [6]. Together with the above research that has identified non-linearity in natural systems, surrogate data analysis provides a means by which...
- 10
- 457
- 0
Báo cáo Y học: Human bile salt-stimulated lipase has a high frequency of size variation due to a hypervariable region in exon 11 pot
... however,abundantly glycosylated and the apparent molecular masson SDS/PAGE has been estimated to 120±140 kDa[11,12]. Human BSSL has a unique primary structure ascompared to other mammalian lipases. ... forsecretion of rat pancreatic BSSL [15]. On the other hand,we and others have shown that t he repeats are completelydispensable for the typical functional properties of BSSL,i.e. catalytic activity, ... molecularmass variants with only half the speci®c activity comparedto the most common variant have been isolated and the concentration of BSSL was co nsiderably lower in milk frommothers carrying...
- 9
- 520
- 0
Báo cáo y học: "Predicting hospital admission and discharge with symptom or function scores in patients with schizophrenia: pooled analysis of a clinical trial extension" doc
... the analysis, execution of the statistical analysis,interpretation of the data, and final approval of the manuscript. RD contributedto the design of the analysis, interpretation of the data, decision ... publish,writing/editing of the text, and final approval of the manuscript. LM contrib-uted to design of the analysis, execution of the statistical analysis, interpreta-tion of the data, and final approval of the ... 9:24http://www.annals-general-psychiatry.com/content/9/1/24Page 5 of 8Table 1: Baseline demographic and patient characteristicsParameter StatisticsNot hospitalized at start of the open-label phaseHospitalized at start of the open-label phaseAge,...
- 8
- 425
- 0
Báo cáo y học: "Estimated intelligence quotient in anorexia nervosa: a systematic review and meta-analysis of the literature" pot
... to the average and 15 to the standarddeviation. This permits direct comparison between indi-vidual scores with the normative data from the sameage range.Data synthesisMeta-analyses were carried ... variation between the results of the various studies and an estimate of the overall effect size of all the studies together considering the data availablefor each study included in the meta-analysis ... mea n and the standard deviation of the norm group are regarded as known (based on a largesample size), a bias correction of the standard error isnot necessary. The effect siz es and standard...
- 10
- 525
- 0
Báo cáo y học: "All-trans retinoic acid suppresses interleukin-6 expression in interleukin-1-stimulated synovial fibroblasts by inhibition of ERK1/2 pathway independently of RAR activation" ppsx
... RP29(sense: AAGATGGGTCACCAGCAGCTCTACTG-3', anti-sense: 5'-AGACGCGGCAAGAGCGAGAA-3', NM 012876,70 bp, 59°C). The quantity of each cDNA was estimated by threshold cycle(Ct), defined as the ... fragments to be amplified. The sequences of the primers used were IL-6 (sense: 5'-CCGGAGAGGAGACT-TCACAG-3', anti-sense: 5'-CCGGAGAGGAGACT-TCACAG-3', NM 012589, 161 base pairs [bp], ... RXR-α (5':GAAGCGTACTGCAAACACAAG-3', anti-sense: 5'-CAGCCGGAGCAGCAGCTTGG-3', NM 012805, 65 bp,66°C), RXR-β (sense: 5'-CTTCATGTGCACAGAAACT-3',anti-sense: 5'-TCTGTCAGCACCCGATCAAA-3',...
- 12
- 386
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Chuong 2 nhận dạng rui roTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam