Báo cáo y học: "Impairment of alternative splice sites defining a novel gammaretroviral exon within gag modifies the oncogenic properties of Akv murine leukemia virus" pdf

Báo cáo y học: "Impairment of alternative splice sites defining a novel gammaretroviral exon within gag modifies the oncogenic properties of Akv murine leukemia virus" pdf

Báo cáo y học: "Impairment of alternative splice sites defining a novel gammaretroviral exon within gag modifies the oncogenic properties of Akv murine leukemia virus" pdf

... point. SD-env [686] SD’ -gag [2092] SA’ -gag [1856] SA-env [5985] LTR CCAGCGATCTATATAACTGGAAAAATAATAATCCATCATTCAGTGAA GAT AAAGAG GTAGGAA CCTCTGATCTATATAACTGGAAAAATAATAATCCTTCCTTCTCTGAG GAT AAAGAG GTAGGAA CCTCTGATCTATATAACTGGAAAAATAATAATCCTTCCTTCTCTGAG ... GTAGGAA CCTCTGATCTATATAACTGGAAAAATAATAATCCTTCCTTCTCTGAG GAT AAAGG G GAC GAAA CCAGCGATCTATATAACTGGAAAAATAATAATCCATCATTCAGTGAA GAT AAAGGG...

Ngày tải lên: 13/08/2014, 05:22

19 178 0
Báo cáo y học: "Distinct signal transduction processes by IL-4 and IL-13 and influences from the Q551R variant of the human IL-4 receptor alpha chain" docx

Báo cáo y học: "Distinct signal transduction processes by IL-4 and IL-13 and influences from the Q551R variant of the human IL-4 receptor alpha chain" docx

... I); E37 5A = 5'- TTAGCCGGGCCACAAAGGCC-3' and 5'-TGGAGAT- CAGCAAGACAGTC-3' (StuI); S478P = 5'-CTTACCG- CAGCTTCAGGTAC-3' and 5'- TTTCTGGCTCAGGTTGGGGC-3' (KpnI); ... Arinobu Y, Enomoto T, Kawai M, Sasaki S, Dake Y, Hamasaki N, Sirakawa T, Hopkin JM: Ile50Val variant of IL-4R alpha upregulates IgE synthesis and associates with atopic asthma. Nat Genet...

Ngày tải lên: 12/08/2014, 18:20

11 384 0
Báo cáo y học: " Cell death upon epigenetic genome methylation: a novel function of methyl-specific deoxyribonucleases" docx

Báo cáo y học: " Cell death upon epigenetic genome methylation: a novel function of methyl-specific deoxyribonucleases" docx

... (5'- GGGggtaccGTGAACAAAAGAGATATACAACTAC-3') and StoMcrBC-rev (5'-GGGgtcgacTTAGATTTTACGATTTTCGCC TTTT-3'), or StoMcrBC2-for (5'-GGGggtaccGTGAGGTTAA- GAAAAAGAGATCTAG-3') and StoMcrBC2-rev ... using the H1-ara (GGTTTCGTTTGATTGGCTGTGGTTTTATACAGTCATTACT GCCCGTAATAGTGTAGGCTGGAGCTGCTTC) and H2-ara- BAD (GGCGTCACACTTTGCTATGCCATAGCATTTTTATCC ATAAGATTAGCGGAATTCCGGGGATCCG...

Ngày tải lên: 14/08/2014, 21:20

22 120 0
Báo cáo y học: " Impairment of chondrocyte biosynthetic activity by exposure to 3-tesla high-field magnetic resonance imaging is temporar" pptx

Báo cáo y học: " Impairment of chondrocyte biosynthetic activity by exposure to 3-tesla high-field magnetic resonance imaging is temporar" pptx

... bp), 5'-AAA CAG ATG AAG AGC TGC ATC CAA-3' (forward) and 5'-CAA AGC TCA TGC AGA ACA CCA CTT-3' (reverse) [26]; β-actin (520 bp), 5'-TGT GAT GGT GGG AAT GGG TCA G-3' ... suggest a decrease in biosynthetic activity, according to the sGAG synthesis rate, of articular chondro- Figure 3 Expression of the cartilage markers aggrecan and collagen type II and al...

Ngày tải lên: 09/08/2014, 08:22

11 419 0
Báo cáo y học: "Impairment of organ-specific T cell negative selection by diabetes susceptibility genes: genomic analysis by mRNA profiling" pot

Báo cáo y học: "Impairment of organ-specific T cell negative selection by diabetes susceptibility genes: genomic analysis by mRNA profiling" pot

... Institute, The Australian National University, Canberra, ACT 2601, Australia. ‡ Biochemistry and Molecular Biology, The Australian National University, Canberra, ACT 2601, Australia. § The Australian ... 43 0A arrays (Santa Clara, CA, USA). Microarray data processing The Affymetrix 43 0A chips were scanned using standard Affymetrix protocols. All arrays passed routine quality con...

Ngày tải lên: 14/08/2014, 17:22

23 221 0
 Báo cáo y học: "Discriminating between elderly and young using a fractal dimension analysis of centre of pressure"

Báo cáo y học: "Discriminating between elderly and young using a fractal dimension analysis of centre of pressure"

... towards recognising the chaotic properties of natural phenomena and the use of appropriate non-linear analysis, such as fractal analysis, in place of traditional analyses [1]. A strong reason ... be indicative of a shift towards an unhealthy or less desirable control strategy. The analysis of fractal patterns in gait and posture data may serve as an indicator of pat...

Ngày tải lên: 03/11/2012, 10:09

10 458 0
Báo cáo Y học: Human bile salt-stimulated lipase has a high frequency of size variation due to a hypervariable region in exon 11 pot

Báo cáo Y học: Human bile salt-stimulated lipase has a high frequency of size variation due to a hypervariable region in exon 11 pot

... however, abundantly glycosylated and the apparent molecular mass on SDS/PAGE has been estimated to 120±140 kDa [11,12]. Human BSSL has a unique primary structure as compared to other mammalian lipases. ... for secretion of rat pancreatic BSSL [15]. On the other hand, we and others have shown that t he repeats are completely dispensable for the typical functional properties of BS...

Ngày tải lên: 24/03/2014, 03:21

9 521 0
Báo cáo y học: "Predicting hospital admission and discharge with symptom or function scores in patients with schizophrenia: pooled analysis of a clinical trial extension" doc

Báo cáo y học: "Predicting hospital admission and discharge with symptom or function scores in patients with schizophrenia: pooled analysis of a clinical trial extension" doc

... the analysis, execution of the statistical analysis, interpretation of the data, and final approval of the manuscript. RD contributed to the design of the analysis, interpretation of the data, decision ... publish, writing/editing of the text, and final approval of the manuscript. LM contrib- uted to design of the analysis, execution of the statistical...

Ngày tải lên: 08/08/2014, 23:21

8 425 0
Báo cáo y học: "Estimated intelligence quotient in anorexia nervosa: a systematic review and meta-analysis of the literature" pot

Báo cáo y học: "Estimated intelligence quotient in anorexia nervosa: a systematic review and meta-analysis of the literature" pot

... to the average and 15 to the standard deviation. This permits direct comparison between indi- vidual scores with the normative data from the same age range. Data synthesis Meta-analyses were carried ... variation between the results of the various studies and an estimate of the overall effect size of all the studies together considering the data available for each stud...

Ngày tải lên: 09/08/2014, 01:21

10 525 0
Báo cáo y học: "All-trans retinoic acid suppresses interleukin-6 expression in interleukin-1-stimulated synovial fibroblasts by inhibition of ERK1/2 pathway independently of RAR activation" ppsx

Báo cáo y học: "All-trans retinoic acid suppresses interleukin-6 expression in interleukin-1-stimulated synovial fibroblasts by inhibition of ERK1/2 pathway independently of RAR activation" ppsx

... RP29 (sense: AAGATGGGTCACCAGCAGCTCTACTG-3', anti- sense: 5'-AGACGCGGCAAGAGCGAGAA-3', NM 012876, 70 bp, 59°C). The quantity of each cDNA was estimated by threshold cycle (Ct), defined as the ... fragments to be amplified. The sequences of the primers used were IL-6 (sense: 5'-CCGGAGAGGAGACT- TCACAG-3', anti-sense: 5'-CCGGAGAGGAGACT- TCACAG-3', NM...

Ngày tải lên: 09/08/2014, 01:22

12 386 0
w