Báo cáo y học: " A real-time view of the TAR:Tat:P-TEFb complex at HIV-1 transcription sites" ppsx

Tài liệu Báo cáo khoa học: "A COMPUTATIONAL VIEW OF THE COGNITIVE SEMANTICS OF SPATIAL PREPOSITIONS*" ppt

Tài liệu Báo cáo khoa học: "A COMPUTATIONAL VIEW OF THE COGNITIVE SEMANTICS OF SPATIAL PREPOSITIONS*" ppt

... Here the x-axis points direction of the half- axis of the particular side of the reference axis in the DCS; and in the case of "in front of& quot; y is the perpendicular direction in the ... of the long desk is a chair. Another chair is to the left of the long desk. The chair in front of the desk is near the short desk." OTHER APPROACH...

Ngày tải lên: 20/02/2014, 21:20

7 552 1
Báo cáo Y học: A functional role of the membrane-proximal extracellular domains of the signal transducer gp130 in heterodimerization with the leukemia inhibitory factor receptor pot

Báo cáo Y học: A functional role of the membrane-proximal extracellular domains of the signal transducer gp130 in heterodimerization with the leukemia inhibitory factor receptor pot

... role of the membrane-proximal extracellular domains of the signal transducer gp130 in heterodimerization with the leukemia inhibitory factor receptor Andreas Timmermann, Andrea Kuă ster, Ingo ... constitutively associates with tyrosine kinases of the Janus kinase (Jak) family. Upon ligand binding the associated Jaks become activated by transphosph...

Ngày tải lên: 18/03/2014, 01:20

11 583 0
Báo cáo khoa học: A biophysical view of the interplay between mechanical forces and signaling pathways during transendothelial cell migration doc

Báo cáo khoa học: A biophysical view of the interplay between mechanical forces and signaling pathways during transendothelial cell migration doc

... junctions, they also may take a transcellular route through the body of the cell; see Carman and Springer [100] for a recent review of transcellular migration of cells. Both transmigration paths are available ... between mechanical forces and signaling pathways during transendothelial cell migration Kimberly M. Stroka and Helim Aranda-Espinoza Fischell...

Ngày tải lên: 22/03/2014, 21:20

14 513 0
Báo cáo y học: "A comparative study of the inhibitory effects of interleukin-1 receptor antagonist following administration as a recombinant protein or by gene transfer." pps

Báo cáo y học: "A comparative study of the inhibitory effects of interleukin-1 receptor antagonist following administration as a recombinant protein or by gene transfer." pps

... IL-1Ra became dramatically apparent, as were the advantages of gene transfer as a means of protein delivery. In the face of continual dilution, the con- stitutive production of the IL-1Ra gene ... potential of this mater- ial. Gene delivery may offer the greatest chance of early success. Recent data from our laboratory have shown that the synovial lining...

Ngày tải lên: 09/08/2014, 01:23

9 422 0
Báo cáo y học: " A promoter haplotype of the interleukin-18 gene is associated with juvenile idiopathic arthritis in the Japanese population" pps

Báo cáo y học: " A promoter haplotype of the interleukin-18 gene is associated with juvenile idiopathic arthritis in the Japanese population" pps

... GAAAGTTTTAACACTGGAAACTGCAA SNP9 allele1 VIC-TTTTGGTAGCCCTCTC-MGB SNP9R TTACACTTTCTGCAACAGAAAGTAAGC SNP9 allele2 FAM-TTTTGGTATCCCTCTCC-MGB SNP11F ACAGGTTTTGGAAGGCACAGA SNP11 VIC- ACGGAAGAAAAGATTT-MGB SNP11R ... FAM-CACTTATCTGTAGAGCTT-MGB SNP4F CTGGCAATTCTGCCTTGTTTCAG SNP4 allele1VIC- CCGAAGATAAAAGAATC-MGB SNP4R GGATTACAGCCGTGAGCCA SNP4 allele2 FAM- CGAAGATAGAAGAATC-MGB SNP5F AAGCTGAGGCAGGAAGAT...

Ngày tải lên: 09/08/2014, 07:20

9 559 0
Báo cáo y học: "A meta-analysis of the incidence of malignancy in adult patients with rheumatoid arthritis" doc

Báo cáo y học: "A meta-analysis of the incidence of malignancy in adult patients with rheumatoid arthritis" doc

... studies comparing the incidence of malignancy in patients with RA versus the general population since these may be expected to provide a realistic perspective on risk in the clinical setting. Materials ... both within-study and between-study variation by incorporating the heterogeneity of effects in the overall analysis. Results A total of 2,093 articles were ide...

Ngày tải lên: 09/08/2014, 10:23

8 413 0
Báo cáo y học: "A meta-analysis of the efficacy of fibromyalgia treatment according to level of care" pptx

Báo cáo y học: "A meta-analysis of the efficacy of fibromyalgia treatment according to level of care" pptx

... 2 Efficacy of the treatments allocated to both levels of care according to the type of pain in patients with fibromyalgiaEfficacy of the treatments allocated to both levels of care according to ... However, to the best of our knowledge this is the first meta-analysis on the efficacy of the treatment of fibromyalgia according to level...

Ngày tải lên: 09/08/2014, 10:23

15 531 0
Báo cáo y học: "A Rasch Analysis of the Manchester Foot Pain and Disability Index" pdf

Báo cáo y học: "A Rasch Analysis of the Manchester Foot Pain and Disability Index" pdf

... Cali- bration of an item pool for assessing the disability associated with foot pain: an application of item response theory to the Manchester Foot Pain and Disability Index. Physiotherapy 2007, 93:89-95. 14. ... Central Page 1 of 10 (page number not for citation purposes) Journal of Foot and Ankle Research Open Access Research A Rasch Analysis of the M...

Ngày tải lên: 10/08/2014, 21:23

10 362 0
Báo cáo y học: "A critical review of the research literature on Six Sigma, Lean and StuderGroup''''s Hardwiring Excellence in the United States: the need to demonstrate and communicate the effectiveness of transformation strategies in healthcare" pdf

Báo cáo y học: "A critical review of the research literature on Six Sigma, Lean and StuderGroup''''s Hardwiring Excellence in the United States: the need to demonstrate and communicate the effectiveness of transformation strategies in healthcare" pdf

... research literature on Six Sigma, Lean and StuderGroup's Hardwiring Excellence in the United States: the need to demonstrate and communicate the effectiveness of transformation strategies in ... information presented. After reviewing the titles, abstracts, and when necessary the full text according to the five review criteria...

Ngày tải lên: 11/08/2014, 05:21

9 823 0
Báo cáo y học: " A systematic review of the use of theory in the design of guideline dissemination and implementation strategies and interpretation of the results of rigorous evaluations" pps

Báo cáo y học: " A systematic review of the use of theory in the design of guideline dissemination and implementation strategies and interpretation of the results of rigorous evaluations" pps

... article as: Davies et al.: A systematic review of the use of theory in the design of guideline dissemination and implementation strategies and interpretation of the results of rigorous evaluations. Implementation ... conducted a systematic review of use of theory in 235 rigorous evaluations of guideline dissemination a...

Ngày tải lên: 11/08/2014, 05:21

6 411 0
Báo cáo y học: "A systematic review of the international published literature relating to quality of institutional care for people with longer term mental health problems" potx

Báo cáo y học: "A systematic review of the international published literature relating to quality of institutional care for people with longer term mental health problems" potx

... undertook a systematic review of the international lit- erature published in peer reviewed journals since 1980 with the aims of: 1. identifying key components of institutional care for people with ... study period compared to those in housing of average or above average quality. In a systematic review of 28 studies of supported housing for people...

Ngày tải lên: 11/08/2014, 17:20

30 476 0
Báo cáo y học: " A reversible lesion of the corpus callosum splenium with adult influenza-associated encephalitis/encephalopathy: a case report" pdf

Báo cáo y học: " A reversible lesion of the corpus callosum splenium with adult influenza-associated encephalitis/encephalopathy: a case report" pdf

... reversible lesion of the corpus callosum splenium with adult influenza-associated encephalitis/encephalopathy: a case report En Kimura*, Sadahisa Okamoto, Yuji Uchida, Tomoo Hirahara, Tokunori Ikeda, ... encephalopathy with reversible lesions of the corpus callosum splenium. Case presentation: A previously healthy 35-year-old man presented with ac...

Ngày tải lên: 11/08/2014, 21:22

5 230 1
Báo cáo y học: "A balanced view of balanced solutions." pps

Báo cáo y học: "A balanced view of balanced solutions." pps

... Cardiopulmonary bypass priming using a high dose of a balanced hydroxyethyl starch versus an albumin-based priming strategy. Anesth Analg 2009, 109:1752-1762. 21. Kulla M, Weidhase R, Lampl L: Hydroxyethyl ... ects of balanced solutions on outcome, we cannot currently recommend changing  uid therapy to the use of a balanced colloid preparation. â 2010 BioMed Central Ltd A b...

Ngày tải lên: 13/08/2014, 21:21

12 417 0
Báo cáo y học: "A global view of gene expression in lithium and zinc treated sea urchin embryos: new components of gene regulatory network" pot

Báo cáo y học: "A global view of gene expression in lithium and zinc treated sea urchin embryos: new components of gene regulatory network" pot

... 5, Article R85 Research A global view of gene expression in lithium and zinc treated sea urchin embryos: new components of gene regulatory networks Albert J Poustka * , Alexander Kühn * , Detlef ... unravel new candidate genes of GRNs, ultimately to move toward a global systems level understanding of sea urchin embryogenesis. Neuronal identity,...

Ngày tải lên: 14/08/2014, 07:21

18 439 0
Báo cáo y học: "A genomic view of methane oxidation by aerobic bacteria and anaerobic archaea" doc

Báo cáo y học: "A genomic view of methane oxidation by aerobic bacteria and anaerobic archaea" doc

... bio- chemistry and regulation of aerobic methane oxidation. In contrast, understanding of the process of anaerobic methane oxidation is in its infancy. Geochemical evidence points strongly towards ... steadily increasing over the past 300 years. There are two major ways in which methane is removed from the environment: aerobic oxidation by a spe- cialized group of...

Ngày tải lên: 14/08/2014, 14:21

6 213 0
Từ khóa:
w