Báo cáo y học: " Caspase-3-mediated cleavage of p65/RelA results in a carboxy-terminal fragment that inhibits IκBα and enhances HIV-1 replication in human T lymphocytes" ppsx

Báo cáo y học: " Caspase-3-mediated cleavage of p65/RelA results in a carboxy-terminal fragment that inhibits IκBα and enhances HIV-1 replication in human T lymphocytes" ppsx

Báo cáo y học: " Caspase-3-mediated cleavage of p65/RelA results in a carboxy-terminal fragment that inhibits IκBα and enhances HIV-1 replication in human T lymphocytes" ppsx

... removes the DNA-binding domain in the amino-terminus of p65/RelA by cleavage at a sequence near a caspase-3 cleavage site, leaving a carboxy-terminal fragment that contains two potent transactivation ... purposes) Retrovirology Open Access Research Caspase-3-mediated cleavage of p65/RelA results in a carboxy-terminal fragment that inhibits IκBα a...

Ngày tải lên: 13/08/2014, 05:21

20 315 0
Báo cáo y học: "Serum levels of autoantibodies against C-reactive protein correlate with renal disease activity and response to therapy in lupus nephritis" pps

Báo cáo y học: "Serum levels of autoantibodies against C-reactive protein correlate with renal disease activity and response to therapy in lupus nephritis" pps

... laboratory work, interpre- tation of data and manuscript writing. AZ contributed to patient characterization, acquisition of data and statistics. TS contributed to the original idea, interpretation ... interpretation of data and man- uscript writing. JW contributed to interpretation of data, statis- tics and manuscript writing. IG contributed to patient characterization, acqui...

Ngày tải lên: 12/08/2014, 11:22

9 284 0
Tài liệu Báo cáo Y học: Differential response of neuronal cells to a fusion protein of ciliary neurotrophic factor/soluble CNTF-receptor and leukemia inhibitory factor pot

Tài liệu Báo cáo Y học: Differential response of neuronal cells to a fusion protein of ciliary neurotrophic factor/soluble CNTF-receptor and leukemia inhibitory factor pot

... activate the MAPK pathway. MAP kinases and STAT3 are rapidly activated within 10 min in response to Hyper-CNTF, the phase of activation lasting for at least 30 min before returning to near basal levels ... MAPK activation by Hyper-CNTF in transfected BAF/3 cells Downstream signal transduction pathways were analyzed by studying the activation level of JAK/STAT and MAP kinase signal...

Ngày tải lên: 22/02/2014, 07:20

9 442 0
Báo cáo y học: "Clinical Management of Adult Patients with a History of Nonsteroidal Anti-Inflammatory Drug–Induced Urticaria/ Angioedema: Update" ppt

Báo cáo y học: "Clinical Management of Adult Patients with a History of Nonsteroidal Anti-Inflammatory Drug–Induced Urticaria/ Angioedema: Update" ppt

... oral tolerance test results. 16 Interestingly, and similarly to patients with aspirin-exacerbated respiratory disease (AERD), in patients with acute urticaria induced by distinct NSAIDs (both with and without ... inflammatory processes, and there is some evidence that they may act as mediators in urticaria. Their intradermal injection elicits a wheal and flare reaction eithe...

Ngày tải lên: 08/08/2014, 21:20

7 488 0
Báo cáo y học: "Stigmatising attitude of medical students towards a psychiatry label." pot

Báo cáo y học: "Stigmatising attitude of medical students towards a psychiatry label." pot

... conceived the study, and participated in its design, acquisition, analysis and interpretation of data, and in the drafting of the manuscript. OO participated in its coordi- nation, statistical analysis ... Abstract Background: The aim of this study is to evaluate the effect of a psychiatric label attached to an apparently normal person on the attitude of final year me...

Ngày tải lên: 08/08/2014, 23:21

4 347 0
Báo cáo y học: "Immunomodulatory properties of mesenchymal stem cells: a review based on an interdisciplinary meeting held at the Kennedy Institute" potx

Báo cáo y học: "Immunomodulatory properties of mesenchymal stem cells: a review based on an interdisciplinary meeting held at the Kennedy Institute" potx

... which an admix of inflammatory and scarring tissue damage is often present. On the other hand, MSCs may also actively participate in initiating AD [3], they have the potential to favour spread of melanoma ... potential synergy and interdisciplinary collaboration. As pointed out by the director of the institute, Marc Feldmann, following the rapidly growing activity in the past fe...

Ngày tải lên: 09/08/2014, 08:23

10 559 0
Báo cáo y học: "Extracellular localization of galectin-3 has a deleterious role in joint tissues" docx

Báo cáo y học: "Extracellular localization of galectin-3 has a deleterious role in joint tissues" docx

... GCATCGTAGGTCTGTCCTG 364 MMP-3 S: GAAAGTCTGGGAAGAGGTGACTCCAC AS: CAGTGTTGGCTGAGTGAAAGAGACCC 284 Osteocalcin S: CATGAGAGCCCTCACA AS: AGAGCGACACCCTAGAC 310 [48] Alkaline phosphatase S: TGCAGTACGAGCTGAACAG AS: ... TGCAGTACGAGCTGAACAG AS: TGAAGACGTGGGAATGGTC 267 Type I collagen α1 chain S: CCGAAGGTTCCCCTGGACGA AS: CGCCCTGTTCGCCTGTCTCA 252 18S S: GAATCAGGGTTCGATTCCG AS: CCAAGATCCAACTACGAGC 279 [29]...

Ngày tải lên: 09/08/2014, 10:20

9 351 0
Báo cáo y học: "Spectrocolorimetric assessment of cartilage plugs after autologous osteochondral grafting: correlations between color indices and histological findings in a rabbit model" ppt

Báo cáo y học: "Spectrocolorimetric assessment of cartilage plugs after autologous osteochondral grafting: correlations between color indices and histological findings in a rabbit model" ppt

... vivo assessment. Introduction Although articular cartilage shows durability and the ability to maintain itself, it has limited capacity for repair [1,2]. The repair cartilage that forms as a result of articular injury ... Assessment of rat articular cartilage matura- tion using 50-MHz quantitative ultrasonography. Osteoarthritis Cartilage 2001, 9:178-186. 20. Hattori K, Ikeuchi K, M...

Ngày tải lên: 09/08/2014, 10:21

9 404 0
Báo cáo y học: "Preclinical characterization of DEKAVIL (F8-IL10), a novel clinical-stage immunocytokine which inhibits the progression of collagen-induced arthritis" ppsx

Báo cáo y học: "Preclinical characterization of DEKAVIL (F8-IL10), a novel clinical-stage immunocytokine which inhibits the progression of collagen-induced arthritis" ppsx

... 5'-TTTTC- CTTTTGCGGCCGCTCATTAGTTTC- GTATCTTCATTGTCATGTA-3', which appended part of a 15 amino acid linker (SSSSG) 3 at its N-terminus and a stop codon and NotI restriction site at its C-terminus. The ... protein L19-IL10 using the following primer sequences: a backward antisense primer, 5' TAATGGTGATGGTGATGGTGGTTTCGTATCTTCATTGT- CATGTAGGCTTC-3'; and a forw...

Ngày tải lên: 09/08/2014, 14:22

15 267 0
Báo cáo y học: "Genome sequence of the necrotrophic plant pathogen Pythium ultimum reveals original pathogenicity mechanisms and effector repertoire." doc

Báo cáo y học: "Genome sequence of the necrotrophic plant pathogen Pythium ultimum reveals original pathogenicity mechanisms and effector repertoire." doc

... metazoans/choanoflagellates. In metazoans, but not in choanoflagellates, some cadherins also con- tain an intracellular catenin-binding domain (CBD) that connects intercellular binding via EC domains to intra- cellular ... highlighting that the CRN family, greatly expanded in Phytophthora [28], had already evolved in the last commo n ancest or of P. ultimum and Phytophthora....

Ngày tải lên: 09/08/2014, 20:22

22 355 0
w