Báo cáo y học: "Natural variation of HIV-1 group M integrase: Implications for a new class of antiretroviral inhibitors" pdf

Báo cáo y học: "Natural variation of HIV-1 group M integrase: Implications for a new class of antiretroviral inhibitors" pdf

Báo cáo y học: "Natural variation of HIV-1 group M integrase: Implications for a new class of antiretroviral inhibitors" pdf

... Shimura K, Kodama E, Sakagami Y, Matsuzaki Y, Watanabe W, Yama- taka K, Watanabe Y, Ohata Y, Doi S, Sato M, Kano M, Ikeda S, Mat- suoka M: Broad Anti-Retroviral Activity and Resistance Profile of ... recombinant HIV-1 [abstract 1]. Antivir Ther 2007, 12:S3. 54. Kodama E, Shimura K, Sakagami Y, Matsuzaki Y, Watanabe W, Yama- taka K, Sato M, Kano M, Ikeda S, Matsuoka M: In vitro...

Ngày tải lên: 13/08/2014, 05:21

11 456 0
Báo cáo Y học: Hemocyanin from the keyhole limpet Megathura crenulata (KLH) carries a novel type of N-glycans with Gal(b1–6)Man-motifs doc

Báo cáo Y học: Hemocyanin from the keyhole limpet Megathura crenulata (KLH) carries a novel type of N-glycans with Gal(b1–6)Man-motifs doc

... complex carbohydrates in small amounts: capillary gas chromatography – mass fragmentography of meth- ylalditol acetates obtained from N-glycosidically linked glyco- protein oligosaccharides. Anal. ... Amsterdam. 48. Takahashi, N., Hitotsuya, H., Hanzawa, H., Arata, Y. & Kur- ihara, Y. (1990) Structural study of asparagine-linked oligo- saccharide moiety of taste-modifying protein,...

Ngày tải lên: 31/03/2014, 08:20

15 482 0
Báo cáo y học: " Numbers needed to treat calculated from responder rates give a better indication of efficacy in osteoarthritis trials than mean pain scores" pptx

Báo cáo y học: " Numbers needed to treat calculated from responder rates give a better indication of efficacy in osteoarthritis trials than mean pain scores" pptx

... originally reported mean differences over pla- cebo of the same order as the Bjordal meta-analysis [1]. They were 8 mm (5 mg), 10 mm (10 mg), 14 mm (30 mg), 22 mm (60 mg) and 19 mm (90 mg) on a 100 ... RH, Max MB: Use of the cumulative propor- tion of responders analysis graph to present pain data over a range of cut-off points: making clinical trial data more understandable. J Pa...

Ngày tải lên: 09/08/2014, 10:23

5 317 0
Báo cáo y học: "Antiphospholipid antibody profiles in lupus nephritis with glomerular microthrombosis: a prospective study of 124 cases" pot

Báo cáo y học: "Antiphospholipid antibody profiles in lupus nephritis with glomerular microthrombosis: a prospective study of 124 cases" pot

... [49]. Many studies have shown that complement activation may play an important role in thrombotic events. aPL may activate the complement pathway, generating split products that lead to fetal loss ... lupus anticoagulant and antibodies against β2 glycoprotein I and thrombin may play a role in GMT. Introduction Systemic lupus erythematosus (SLE) is a multisystem autoim- mune disease. Appro...

Ngày tải lên: 09/08/2014, 14:21

9 413 0
Báo cáo y học: " Inhaled salmeterol and/or fluticasone alters structure/function in a murine model of allergic airways disease" potx

Báo cáo y học: " Inhaled salmeterol and/or fluticasone alters structure/function in a murine model of allergic airways disease" potx

... clinical immunology 1998, 102:531-538. 29. Kamachi A, Munakata M, Nasuhara Y, Nishimura M, Ohtsuka Y, Amishima M, Takahashi T, Homma Y, Kawakami Y: Enhancement of goblet cell hyperplasia and airway ... hyperresponsiveness by salbutamol in a rat model of atopic asthma. Thorax 2001, 56:19-24. 30. Tamaoki J, Tagaya E, Kawatani K, Nakata J, Endo Y, Nagai A: Airway Mucosal Thicken...

Ngày tải lên: 12/08/2014, 11:20

11 374 0
Báo cáo y học: "Percutaneous tracheostomy in patients with severe liver disease and a high incidence of refractory coagulopathy: a prospective trial" doc

Báo cáo y học: "Percutaneous tracheostomy in patients with severe liver disease and a high incidence of refractory coagulopathy: a prospective trial" doc

... in the absence of any stomal or intratracheal haemorrhage, was not deemed to be a complication of the procedure. Statistical analysis Data are presented as median and range or as number and per- centage ... from disseminated intravascular coagulation at the time the trache- ostomy was performed bled significantly (mainly extratracheally and greater than 150 mL) and required emer- gency...

Ngày tải lên: 13/08/2014, 08:20

7 315 0
Báo cáo y học: "Mutation in the loop C-terminal to the cyclophilin A binding site of HIV-1 capsid protein disrupts proper virus assembly and infectivity" ppt

Báo cáo y học: "Mutation in the loop C-terminal to the cyclophilin A binding site of HIV-1 capsid protein disrupts proper virus assembly and infectivity" ppt

... Berthet-Colominas C, Novelli A, Battai N, Piga N, Cheynet V, Mallet F, Cusack S: Mutual conformational adapta- tions in antigen and antibody upon complex formation between an Fab and HIV-1 capsid protein ... viral RNA. The outer primer pair 5'-GCA GTG GCG CCC GAA CAG and 5'-TTCTGA TAA TGC TGA AAA CAT GGG TAT and inner primer pair 5'-CTC TCG ACG CAG GAC TC and 5'-ACC CA...

Ngày tải lên: 13/08/2014, 09:20

8 266 0
Báo cáo y học: " SIVdrl detection in captive mandrills: are mandrills infected with a third strain of simian immunodeficiency virus?" potx

Báo cáo y học: " SIVdrl detection in captive mandrills: are mandrills infected with a third strain of simian immunodeficiency virus?" potx

... University of Amsterdam, Meibergdreef 15, 1105 AZ Amsterdam, The Netherlands, 2 Artis, Plantage Kerklaan 38–40, 1018 CZ Amsterdam, The Netherlands and 3 Department of Virology, Erasmus Medical Centre, ... 3' first primer SIVmnd1C AGATTATAGACCCTATACTGC 5'second primer C-D* = 282 nt SIVmnd1D CATCCAATGAAAGGGAGGTTC 3' second primer SIVmnd 2A GGACATAGGGGATGCCTATT 5' fir...

Ngày tải lên: 13/08/2014, 13:20

5 161 0
Báo cáo y học: "Background: Mood disorders including depression and bipolar disorders are a major cause of morbidity in childhood and adolescence, and hospitalizations for mood disorders are the leading diagnosis for all hospitalizations in general hospit

Báo cáo y học: "Background: Mood disorders including depression and bipolar disorders are a major cause of morbidity in childhood and adolescence, and hospitalizations for mood disorders are the leading diagnosis for all hospitalizations in general hospit

... Agency for Healthcare Research and Quality. The KID is a prob- ability-based sample of pediatric stays from all hospitals that contribute data to HCUP. For each hospital, 10 per- cent of normal ... short-term, acute care hospitals (termed “community hospitals” by the American Hospital Association). Stays in specialized substance abuse and psychiatric facilities are excluded, but sta...

Ngày tải lên: 13/08/2014, 18:22

9 449 0
Báo cáo y học: " WT1 PEPTIDE VACCINATION IN COMBINATION WITH IMATINIB THERAPY FOR A PATIENT WITH CML IN THE CHRONIC PHASE"

Báo cáo y học: " WT1 PEPTIDE VACCINATION IN COMBINATION WITH IMATINIB THERAPY FOR A PATIENT WITH CML IN THE CHRONIC PHASE"

... 40 6a. 27. Oka Y, Tsuboi A, Murakami M, Hirai M, Tominaga N, Nakajima H, Elisseeva OA, Masuda T, Nakano A, Kawakami M, Oji Y, Ikegame K, Hosen N, Udaka K, Yasukawa M, Ogawa H, Kawase I, Sugiyama ... Manabu Kawa- kami 5 , Yoshihiro Oka 6 , Haruo Sugiyama 6 and Masuhiro Takahashi 1 1. Laboratory of Hematology and Oncology, Graduate School of Health Sciences, Niigata Universit...

Ngày tải lên: 26/10/2012, 09:39

10 740 0
w