Báo cáo y học: "Highly specific inhibition of leukaemia virus membrane fusion by interaction of peptide antagonists with a conserved region of the coiled coil of envelope" potx
Báo cáo y học: "Highly specific inhibition of leukaemia virus membrane fusion by interaction of peptide antagonists with a conserved region of the coiled coil of envelope" potx
... purposes)
Retrovirology
Open Access
Research
Highly specific inhibition of leukaemia virus membrane fusion by
interaction of peptide antagonists with a conserved region of the
coiled coil of envelope
Daniel Lamb
1
, ... and coiled coil, which will facilitate comparative analysis of leukaemia
virus TM function and may provide information of...
Báo cáo y học: "Correction: Extravascular lung water index measurement in critically ill children does not correlate with a chest x-ray score of pulmonary edem" doc
... Table 2. Patient characteristics per patient
Probability Probability
of death of death
Patient Age Weight Length of PICU Ventilator PRISM II PIM
number Gender (months) (kg) Diagnosis stay ... Diagnosis stay (days) days % % Outcome
1 F 24 14.0 Near Drowning 19 17 85 60 survived
2 F 83 18.0 Reconstruction of pulmonary artery 18 16 7 6 survived
3 F 23 14.0 Abdominal surgery 5 3...
Báo cáo y học: "Two specific drugs, BMS-345541 and purvalanol A induce apoptosis of HTLV-1 infected cells through inhibition of the NF-kappaB and cell cycle pathways" ppsx
... Watanabe M, Ohsugi T, Shoda M, Ishida T, Aizawa S, Maruyama-Nagai
M, Utsunomiya A, Koga S, Yamada Y, Kamihira S, Okayama A, Kikuchi
H, Uozumi K, Yamaguchi K, Higashihara M, Umezawa K, Watanabe ... Dewan MZ, Terashima K, Taruishi M, Hasegawa H, Ito M, Tanaka Y,
Mori N, Sata T, Koyanagi Y, Maeda M, Kubuki Y, Okayama A, Fujii M,
Yamamoto N: Rapid tumor formation of human T-cell leuke-...
Báo cáo y học: "Highly efficient genetic transduction of primary human synoviocytes with concentrated retroviral supernatant" pdf
... Centrifu-
gation of retroviral supernatant is a potentially attractive
approach to viral concentration because of the wide avail-
ability of centrifuge equipment, the simplicity of the tech-
Available ... developed a flow cytometry assay to rapidly measure
the titer of infectious viral particles (Fig. 1). This assay
takes advantage of the fluorescent properties of...
Báo cáo y học: "Tissue-specific spatial organization of genomes" docx
... (Figure 4a) . A close pair was defined as two chromo-
somes separated by less than 20% of nuclear diameter and
results were statistically analyzed by contingency table analy-
sis [10]. In hepatocytes, ... Ramos C, da Silva MG, Parreira A, Parreira L: The nuclear
topography of ABL, BCR, PML, and RARalpha genes: evi-
dence for gene proximity in specific phases of the cell cyc...
Báo cáo y học: "Homoeolog-specific retention and use in allotetraploid Arabidopsis suecica depends on parent of origin and network partners" doc
... GGTAGG AGAAGGGTCAAA GAGGAT AACGGA TGAGTAT GCGCGGTCT GCTATAGATTGGGGA
A G T T A .T T A G A A .T G A G A G C
.
.A G T T A .T T A. G A A T G A . A
G T T A .T T A G A T G A A
T T A .T T A G.G A. GA
T ... arrays to compare gene expression
between At, Aa, and F
1
As. More than 15% of transcripts
AT1
G
65450.1
GGTTTTAACCGCATACGCAAAGGAGAAATG CAAGGC ATTGCTTGAAG...
Báo cáo y học: " Allele-specific copy number analysis of tumor samples with aneuploidy and tumor heterogeneity" ppt
... gratitude to Ms. Karolina Edlund for expert assistance in
DNA isolation and analysis as well as Mrs. Maria Rydåker at the Uppsala Array Platform
for the SNP array analysis. Mrs. Lena Lenhammar ... an allele frequency cut-off. TAPS is available from the authors
[16].
All aberrations in a single sample are visualized by plotting the Allelic Imbalance Ratio
against the avera...
Báo cáo y học: "Gender-specific effects of HIV protease inhibitors on body mass in mice" ppt
... [35].
Statistics
Data were analyzed by two-way analysis of variance
(ANOVA), one-way ANOVA, and the Student Newman-
Keuls T-test was used for post-hoc comparisons, where
appropriate. Significance was ... induced by HIV protease inhibitors
in an environment of elevated cholesterol.
Background
The use of highly active anti-retroviral therapy (HAART)
has dramatically increased the...
Báo cáo y học: "Anti-oxidant inhibition of hyaluronan fragment-induced inflammatory gene expression" pps
... stimulated with HA
fragments and NAC for 18 h; cell supernatants were har-
vested and analyzed for specific chemokine and cytokine
expression by ELISA. As was the case for macrophages,
NAC markedly ... to phagocytic
cells as we demonstrate a similar inhibition of HA frag-
ment induced IP-10 in a human airway epithelial cells.
Mechanistically the anti-oxidants NAC and DMSO in...
Báo cáo y học: " Highly variable pharmacokinetics of dexmedetomidine during intensive care: a case report" docx
... its plasma clearance and the rate of infusion.
Accordingly, the calculated clearance of dexmedetomi-
dine was increased by 60%. The reason for the increased
clearance can only be speculated.
Dexmedetomidine ... of
dexmedetomidine, the change to another alpha2-adreno-
ceptor agonist was probably unnecessary.
Our patient developed optic neuropathy probably
because of cerebra...
Từ khóa: