Báo cáo y học: "Highly specific inhibition of leukaemia virus membrane fusion by interaction of peptide antagonists with a conserved region of the coiled coil of envelope" potx

... purposes) Retrovirology Open Access Research Highly specific inhibition of leukaemia virus membrane fusion by interaction of peptide antagonists with a conserved region of the coiled coil of envelope Daniel Lamb 1 , ... and coiled coil, which will facilitate comparative analysis of leukaemia virus TM function and may provide information of...

Ngày tải lên: 13/08/2014, 05:21

... Table 2. Patient characteristics per patient Probability Probability of death of death Patient Age Weight Length of PICU Ventilator PRISM II PIM number Gender (months) (kg) Diagnosis stay ... Diagnosis stay (days) days % % Outcome 1 F 24 14.0 Near Drowning 19 17 85 60 survived 2 F 83 18.0 Reconstruction of pulmonary artery 18 16 7 6 survived 3 F 23 14.0 Abdominal surgery 5 3...

Ngày tải lên: 13/08/2014, 21:21

... Watanabe M, Ohsugi T, Shoda M, Ishida T, Aizawa S, Maruyama-Nagai M, Utsunomiya A, Koga S, Yamada Y, Kamihira S, Okayama A, Kikuchi H, Uozumi K, Yamaguchi K, Higashihara M, Umezawa K, Watanabe ... Dewan MZ, Terashima K, Taruishi M, Hasegawa H, Ito M, Tanaka Y, Mori N, Sata T, Koyanagi Y, Maeda M, Kubuki Y, Okayama A, Fujii M, Yamamoto N: Rapid tumor formation of human T-cell leuke-...

Ngày tải lên: 10/08/2014, 05:21

... Centrifu- gation of retroviral supernatant is a potentially attractive approach to viral concentration because of the wide avail- ability of centrifuge equipment, the simplicity of the tech- Available ... developed a flow cytometry assay to rapidly measure the titer of infectious viral particles (Fig. 1). This assay takes advantage of the fluorescent properties of...

Ngày tải lên: 09/08/2014, 03:24

... (Figure 4a) . A close pair was defined as two chromo- somes separated by less than 20% of nuclear diameter and results were statistically analyzed by contingency table analy- sis [10]. In hepatocytes, ... Ramos C, da Silva MG, Parreira A, Parreira L: The nuclear topography of ABL, BCR, PML, and RARalpha genes: evi- dence for gene proximity in specific phases of the cell cyc...

Ngày tải lên: 09/08/2014, 20:20

... GGTAGG AGAAGGGTCAAA GAGGAT AACGGA TGAGTAT GCGCGGTCT GCTATAGATTGGGGA A G T T A .T T A G A A .T G A G A G C . .A G T T A .T T A. G A A T G A . A G T T A .T T A G A T G A A T T A .T T A G.G A. GA T ... arrays to compare gene expression between At, Aa, and F 1 As. More than 15% of transcripts AT1 G 65450.1 GGTTTTAACCGCATACGCAAAGGAGAAATG CAAGGC ATTGCTTGAAG...

Ngày tải lên: 09/08/2014, 22:23

... gratitude to Ms. Karolina Edlund for expert assistance in DNA isolation and analysis as well as Mrs. Maria Rydåker at the Uppsala Array Platform for the SNP array analysis. Mrs. Lena Lenhammar ... an allele frequency cut-off. TAPS is available from the authors [16]. All aberrations in a single sample are visualized by plotting the Allelic Imbalance Ratio against the avera...

Ngày tải lên: 09/08/2014, 23:20

... [35]. Statistics Data were analyzed by two-way analysis of variance (ANOVA), one-way ANOVA, and the Student Newman- Keuls T-test was used for post-hoc comparisons, where appropriate. Significance was ... induced by HIV protease inhibitors in an environment of elevated cholesterol. Background The use of highly active anti-retroviral therapy (HAART) has dramatically increased the...

Ngày tải lên: 10/08/2014, 05:20

... stimulated with HA fragments and NAC for 18 h; cell supernatants were har- vested and analyzed for specific chemokine and cytokine expression by ELISA. As was the case for macrophages, NAC markedly ... to phagocytic cells as we demonstrate a similar inhibition of HA frag- ment induced IP-10 in a human airway epithelial cells. Mechanistically the anti-oxidants NAC and DMSO in...

Ngày tải lên: 11/08/2014, 08:22

... its plasma clearance and the rate of infusion. Accordingly, the calculated clearance of dexmedetomi- dine was increased by 60%. The reason for the increased clearance can only be speculated. Dexmedetomidine ... of dexmedetomidine, the change to another alpha2-adreno- ceptor agonist was probably unnecessary. Our patient developed optic neuropathy probably because of cerebra...

Ngày tải lên: 11/08/2014, 11:23