Báo cáo y học: "Impaired nuclear import and viral incorporation of Vpr derived from a HIV long-term non-progressor" docx

Báo cáo y học: "Impaired nuclear import and viral incorporation of Vpr derived from a HIV long-term non-progressor" docx

Báo cáo y học: "Impaired nuclear import and viral incorporation of Vpr derived from a HIV long-term non-progressor" docx

... non-progressor Leon Caly 1 , Nitin K Saksena 2 , Sabine C Piller 3,4 and David A Jans* 1 Address: 1 Department of Biochemistry and Molecular Biology, Monash University, Clayton, Victoria 3800, Australia, 2 Retroviral ... levels significantly reduced compared to wildtype (Fig. 1B). Sequence analysis revealed that all clones with reduced nuclear accumulation (Vpr A6 -2 and Vpr...

Ngày tải lên: 13/08/2014, 05:21

7 268 0
Báo cáo y học: "Lifetime health effects and medical costs of integrated stroke services - a non-randomized controlled cluster-trial based life table approach"

Báo cáo y học: "Lifetime health effects and medical costs of integrated stroke services - a non-randomized controlled cluster-trial based life table approach"

... is substantial (about half a QALY), especially as compared to the total number of QALYs usually lived after a stroke (on average 2.42 for men and 3.33 for women in usual care). The estimated lifetime ... events separately. Finally, patients can leave the model because of any other, (iv) non-related cause of death. All death, incidence and recurrences rates are stroke severity sp...

Ngày tải lên: 25/10/2012, 10:35

10 569 0
Báo cáo y học: " Magnetic resonance imaging and mammographic appearance of dermatofibrosarcoma protuberans in a male breast: a case report and literature review" doc

Báo cáo y học: " Magnetic resonance imaging and mammographic appearance of dermatofibrosarcoma protuberans in a male breast: a case report and literature review" doc

... Dermatofibrosarcoma protuberans is a rare soft tissue sarcoma and its occurrence on the breast is even rarer. Mammography and magnetic resonance imaging can help in characterizing the lesion and ... Bai 1 and Xian Zhao 1 Addresses: 1 Department of Radiology, Second Hospital of Medical College of Xi’an Jiaotong University Xi’an, Shaanxi, China, 2 Department of Radiology, Good...

Ngày tải lên: 11/08/2014, 14:20

4 411 0
Báo cáo y học: "HLA-DR regulation and the influence of GM-CSF on transcription, surface expression and shedding

Báo cáo y học: "HLA-DR regulation and the influence of GM-CSF on transcription, surface expression and shedding

... study [22]. Sample preparation and flow cytometry Arterial blood was collected from septic patients on the day sepsis was diagnosed (day 0) and on days 3, 7, and 14 for PCR studies and days ... Star). Forward HLA-DR Primer: ATCATGACAAAGCGCTCCAACTAT Reverse HLA-DR Primer: GATGCCCACCAGACCCACAG (Sigma, UK) Soluble HLA-DR measurement by ELISA Ninety six well ELISA plates (Nunc, D...

Ngày tải lên: 03/11/2012, 09:57

11 619 0
Báo cáo Y học: Synthesis, conformational analysis and biological activity of cyclic analogs of the octadecaneuropeptide ODN Design of a potent endozepine antagonist pot

Báo cáo Y học: Synthesis, conformational analysis and biological activity of cyclic analogs of the octadecaneuropeptide ODN Design of a potent endozepine antagonist pot

... become a standard strategy in medicinal chemistry for increasing the receptor affinity and selectivity of peptide ligands [13,14,27]. The Ala-scan of OP has revealed that the side chain of each residue ... structure determination (file parallhdg.pro and topallhdg.pro) was used, and an initial structure was built by randomly generating F and C angles. In the calculations starting...

Ngày tải lên: 24/03/2014, 04:21

13 632 0
Báo cáo Y học: Azidothymidine causes functional and structural destruction of mitochondria, glutathione deficiency and HIV-1 promoter sensitization pptx

Báo cáo Y học: Azidothymidine causes functional and structural destruction of mitochondria, glutathione deficiency and HIV-1 promoter sensitization pptx

... from nonacetylated chloramphenicol by ascending thin-layer chromatography [18]. Chromatograms were examined and quantified with a Fuji image analyzer BA100. HIV- 1-LTR DNA binding assay HIV- 1-LTR DNA ... & Ames, B.N. (1987) Normal oxidative damage to mitochondrial and nuclear DNA is extensive. Proc. Natl Acad. Sci. USA 85, 6465–6467. 25. Hayakawa, M., Ogawa, T., Sugiyama, S.,...

Ngày tải lên: 24/03/2014, 04:21

7 378 0
Báo cáo Y học: Changes in ultrastructure and the occurrence of permeability transition in mitochondria during rat liver regeneration ppt

Báo cáo Y học: Changes in ultrastructure and the occurrence of permeability transition in mitochondria during rat liver regeneration ppt

... GDH and AAT activity in mitochondria and cytosols isolated at 24 h after PH and the enzyme activities in mitochondria and cyto- sols isolated from control rats or at 96 h after PH are statistically significant ... release from mitochondria during reoxygenation of rat liver. Transplantation 57, 144–148. 35. Takahasi, H. & Yamaguchi, M. (1996) Enhancement of plasma membrane (...

Ngày tải lên: 24/03/2014, 04:21

9 494 0
Báo cáo y học: "On demand treatment and home therapy of hereditary angioedema in Germany - the Frankfurt experience" pptx

Báo cáo y học: "On demand treatment and home therapy of hereditary angioedema in Germany - the Frankfurt experience" pptx

... current state -of- the-art review, VII: Canadian Hungarian 2007 International Consensus Algorithm for the Diagnosis, Therapy, and Managment of Hereditary Angioedema. Ann Allergy Asthma Immunol 2008, ... 10:118-133. doi:10.1186/1710-1492-6-21 Cite this article as: Aygören-Pürsün et al.: On demand treatment and home therapy of hereditary angioedema in Germany - the Frankfurt experience....

Ngày tải lên: 08/08/2014, 21:20

4 520 0
Báo cáo y học: "Improved cartilage integration and interfacial strength after enzymatic treatment in a cartilage transplantation model" potx

Báo cáo y học: "Improved cartilage integration and interfacial strength after enzymatic treatment in a cartilage transplantation model" potx

... investigate whether treatment of articular cartilage with hyaluronidase and collagenase enhances histological and mechanical integration of a cartilage graft into a defect. Discs of 3 mm diameter ... these techniques are generally not directly aimed at local integra- tion with the surrounding healthy cartilage. Variable and suboptimal wound healing and integration may be a...

Ngày tải lên: 09/08/2014, 01:24

8 477 0
Báo cáo y học: "E3 ubiquitin ligases and their control of T cell autoreactivity" potx

Báo cáo y học: "E3 ubiquitin ligases and their control of T cell autoreactivity" potx

... ligases GRAIL, Cbl-b, Itch, and NEDD4 ubiquitinate and chaperone critical proximal signaling molecules into an endocytic pathway and direct them away from the immunological synapse and into a lyso- somal ... activation of CD25 – T cells through an activation of a TGFβ receptor-Smad2 pathway [55]. The activation of Smurf1 E3 ligase activity leads to a ubiquitination and...

Ngày tải lên: 09/08/2014, 07:20

10 392 0
w