Báo cáo y học: " VSV-G pseudotyping rescues HIV-1 CA mutations that impair core assembly or stability" pptx

Báo cáo y học: " VSV-G pseudotyping rescues HIV-1 CA mutations that impair core assembly or stability" pptx

Báo cáo y học: " VSV-G pseudotyping rescues HIV-1 CA mutations that impair core assembly or stability" pptx

... core assembly. Thus, this study does not confirm a previous report by Wacharapornin et al. [28] stating that assembled cores may be purified from S 109 A mutated viruses. Impairment of core assembly ... specifically amplify the LTR-LTR junction, we found that all CA mutants were impaired for 2-LTR circle formation (Figure 3C). Altogether, these data indicate that CA mutation...

Ngày tải lên: 13/08/2014, 05:21

15 149 0
Tài liệu Báo cáo Y học: The RuvABC resolvasome Quantitative analysis of RuvA and RuvC assembly on junction DNA doc

Tài liệu Báo cáo Y học: The RuvABC resolvasome Quantitative analysis of RuvA and RuvC assembly on junction DNA doc

... TGCCGAATTCTACCAGTGCCAGTGAAGGACATCTTTGCCCACGTTGACCC HJ8 CAACGTCATAGACGATTACATTGCTACATGGAGCTGTCTAGAGGATCCGA HJ1 AGAAGCTCCATGTAGCAAGGCTAG HJ2 CTAGCCTTGCTAGGACATCTTCCG HJ3 CGGAAGATGTCCATCTGTTGTAGG HJ4 ... CTGGATGTTGTACGTGACCGGACGATACTGTAGCATT DU1 Bio-GTACGAGCAGCTCCCGGGTCAGTCTGCCTA DU2 TAGGCAGACTGACCCGGGAGCTGCTCGTAC HJ5 Bio-AAAAATGGGTCAACGTGGGCAAAGATGTCCTAGCAATGTAATCGTCTATGACGTT HJ6 GTCGGATCCTCTAG...

Ngày tải lên: 21/02/2014, 01:21

10 673 0
Tài liệu Báo cáo Y học: Regulated expression and intracellular localization of cystatin F in human U937 cells pptx

Tài liệu Báo cáo Y học: Regulated expression and intracellular localization of cystatin F in human U937 cells pptx

... composition analysis [5]. It is also noteworthy that all three forms were partially purified by their affinity to Cm-papain, strongly indicating that the carbohydrate side chains do not affect the enzyme-binding ... which correlate exactly with the mobilities of di-, mono- and unglycosylated forms of recombinant cystatin F previously characterized by enzymatic removal of N-linked carbohydra...

Ngày tải lên: 21/02/2014, 01:21

10 536 0
Tài liệu Báo cáo Y học: The Ikaros family protein Eos associates with C-terminal-binding protein corepressors pptx

Tài liệu Báo cáo Y học: The Ikaros family protein Eos associates with C-terminal-binding protein corepressors pptx

... Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 30. Sundqvist, A., Sollerbrant, K. & Svensson, C. (1998) The carboxy- terminal region ... within its repression domain. We conclude that several Ikaros family proteins utilize CtBP corepressors to inhibit gene expression. Keywords: corepressors; gene regulation; Ikaros; repressi...

Ngày tải lên: 21/02/2014, 01:21

8 335 0
Báo cáo Y học: Purification, crystallization, NMR spectroscopy and biochemical analyses of a-phycoerythrocyanin peptides pptx

Báo cáo Y học: Purification, crystallization, NMR spectroscopy and biochemical analyses of a-phycoerythrocyanin peptides pptx

... PecE/PecF, a lyase-isomeraseforthephotoactive3 1 -Cys-a84-phycoviolobilin chromophore of phycoerythrocyanin. Biochemistry 40, 12444– 12456. Ó FEBS 2002 Analyses of a-phycoerythrocyanin peptides (Eur. ... phycobiliprotein lyase: both the attachment of phy- cocyanobilin and the isomerization to phycoviolobilin are cata- lyzed by the proteins PecE and PecF encoded by the phycoerythrocyanin opero...

Ngày tải lên: 17/03/2014, 10:20

10 452 1
Báo cáo Y học: Effect of the disease-causing mutations identified in human ribonuclease (RNase) H2 on the activities and stabilities of yeast RNase H2 and archaeal RNase HII pot

Báo cáo Y học: Effect of the disease-causing mutations identified in human ribonuclease (RNase) H2 on the activities and stabilities of yeast RNase H2 and archaeal RNase HII pot

... are represented by upper- case and lowercase letters, respectively. FAM represents 6-carboxyfluorescein. All oligonucleotides were synthesized by Hokkaido System Science. Hydrolysis of the substrate ... Tadokoro and A. Mukaiyama for helpful discussions. This work was supported in part by a Grant-in-Aid for Scientific Research on Priority Areas ‘Systems Genomics’ from the Ministry of Edu- cation...

Ngày tải lên: 17/03/2014, 17:20

14 483 0
Báo cáo Y học: Characterization of the active site of histidine ammonia-lyase from Pseudomonas putida pptx

Báo cáo Y học: Characterization of the active site of histidine ammonia-lyase from Pseudomonas putida pptx

... this chemically unprecedented chromophore was calculated in a truncated model at the PM3 level of theory (Fig. 3). Spectra for the protonated MIO structures (fully protonated at the carbonyl O, at ... proposed for the reaction catalysed by the homologous enzyme phenylalanine ammonia-lyase (PAL, EC 4.3.1.5) which converts L-phenylalanine into trans-cinnamic acid, a precursor of a great variety...

Ngày tải lên: 18/03/2014, 01:20

9 387 0
Báo cáo Y học: Probing the rotor subunit interface of the ATP synthase from Ilyobacter tartaricus pptx

Báo cáo Y học: Probing the rotor subunit interface of the ATP synthase from Ilyobacter tartaricus pptx

... for ATP hydrolysis, F 1 converts the chemical energy of ATP hydrolysis into torque causing the F o motor to act as an ion pump (for reviews, see [1–4]). Rotation of the asymmetric Keywords c ring; ... implications for enzyme regula- tion. J Biol Chem 279, 35616–35621. 54 Kagawa Y & Racker E (1966) Partial resolution of the enzymes catalyzing oxidative phosphorylation. X. Cor- relation o...

Ngày tải lên: 24/03/2014, 00:21

13 448 0
Báo cáo y học: "The anti-inflammatory effects of levocetirizine - are they clinically relevant or just an interesting additional effect" pptx

Báo cáo y học: "The anti-inflammatory effects of levocetirizine - are they clinically relevant or just an interesting additional effect" pptx

... 5 (page number not for citation purposes) Allergy, Asthma & Clinical Immunology Open Access Review The anti-inflammatory effects of levocetirizine - are they clinically relevant or just an interesting ... has pharmacodynamically and pharmacokinetically favourable characteristics, including rapid onset of action, high bioavailability, high affinity for and occupancy of the H1-receptor,...

Ngày tải lên: 08/08/2014, 21:20

5 392 0
Báo cáo y học: "Impact of methylphenidate formulation on treatment patterns and hospitalizations: a retrospective analysis" pptx

Báo cáo y học: "Impact of methylphenidate formulation on treatment patterns and hospitalizations: a retrospective analysis" pptx

... attention-deficit/ hyperactivity disorder. Biol Psychiatry 2003, 54:1465-1468. 20. Marks DJ, Newcorn JH, Halperin JM: Comorbidity in Adults with attention-deficit/hyperactivity disorder. Ann NY Acad Sci ... of the workplace and job satisfaction. In Ph D thesis U California Berkeley; 2000. 16. Murphy K, Barkley RA: Attention deficit hyperactivity disorder adults: Comorbidities and adaptive im...

Ngày tải lên: 08/08/2014, 21:20

8 385 0
Từ khóa:
w