Báo cáo y học: " VSV-G pseudotyping rescues HIV-1 CA mutations that impair core assembly or stability" pptx
Báo cáo y học: " VSV-G pseudotyping rescues HIV-1 CA mutations that impair core assembly or stability" pptx
... core assembly. Thus, this study does
not confirm a previous report by Wacharapornin et al.
[28] stating that assembled cores may be purified from
S
109
A mutated viruses. Impairment of core assembly ... specifically amplify the LTR-LTR junction, we
found that all CA mutants were impaired for 2-LTR circle
formation (Figure 3C). Altogether, these data indicate that
CA mutation...
Tài liệu Báo cáo Y học: The RuvABC resolvasome Quantitative analysis of RuvA and RuvC assembly on junction DNA doc
... TGCCGAATTCTACCAGTGCCAGTGAAGGACATCTTTGCCCACGTTGACCC
HJ8 CAACGTCATAGACGATTACATTGCTACATGGAGCTGTCTAGAGGATCCGA
HJ1 AGAAGCTCCATGTAGCAAGGCTAG
HJ2 CTAGCCTTGCTAGGACATCTTCCG
HJ3 CGGAAGATGTCCATCTGTTGTAGG
HJ4 ... CTGGATGTTGTACGTGACCGGACGATACTGTAGCATT
DU1 Bio-GTACGAGCAGCTCCCGGGTCAGTCTGCCTA
DU2 TAGGCAGACTGACCCGGGAGCTGCTCGTAC
HJ5 Bio-AAAAATGGGTCAACGTGGGCAAAGATGTCCTAGCAATGTAATCGTCTATGACGTT
HJ6 GTCGGATCCTCTAG...
Tài liệu Báo cáo Y học: Regulated expression and intracellular localization of cystatin F in human U937 cells pptx
... composition
analysis [5]. It is also noteworthy that all three forms were
partially purified by their affinity to Cm-papain, strongly
indicating that the carbohydrate side chains do not affect the
enzyme-binding ... which correlate exactly with the mobilities of
di-, mono- and unglycosylated forms of recombinant
cystatin F previously characterized by enzymatic removal
of N-linked carbohydra...
Tài liệu Báo cáo Y học: The Ikaros family protein Eos associates with C-terminal-binding protein corepressors pptx
... Molecular
Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY.
30. Sundqvist, A., Sollerbrant, K. & Svensson, C. (1998) The carboxy-
terminal region ... within its repression domain. We conclude
that several Ikaros family proteins utilize CtBP corepressors
to inhibit gene expression.
Keywords: corepressors; gene regulation; Ikaros; repressi...
Báo cáo Y học: Purification, crystallization, NMR spectroscopy and biochemical analyses of a-phycoerythrocyanin peptides pptx
... PecE/PecF, a
lyase-isomeraseforthephotoactive3
1
-Cys-a84-phycoviolobilin
chromophore of phycoerythrocyanin. Biochemistry 40, 12444–
12456.
Ó FEBS 2002 Analyses of a-phycoerythrocyanin peptides (Eur. ... phycobiliprotein lyase: both the attachment of phy-
cocyanobilin and the isomerization to phycoviolobilin are cata-
lyzed by the proteins PecE and PecF encoded by the
phycoerythrocyanin opero...
Báo cáo Y học: Effect of the disease-causing mutations identified in human ribonuclease (RNase) H2 on the activities and stabilities of yeast RNase H2 and archaeal RNase HII pot
... are represented by upper-
case and lowercase letters, respectively. FAM represents
6-carboxyfluorescein. All oligonucleotides were synthesized
by Hokkaido System Science. Hydrolysis of the substrate ... Tadokoro and A. Mukaiyama for
helpful discussions. This work was supported in part
by a Grant-in-Aid for Scientific Research on Priority
Areas ‘Systems Genomics’ from the Ministry of Edu-
cation...
Báo cáo Y học: Characterization of the active site of histidine ammonia-lyase from Pseudomonas putida pptx
... this
chemically unprecedented chromophore was calculated in a
truncated model at the
PM3 level of theory (Fig. 3). Spectra
for the protonated MIO structures (fully protonated at the
carbonyl O, at ... proposed for the reaction catalysed by the homologous
enzyme phenylalanine ammonia-lyase (PAL, EC 4.3.1.5)
which converts
L-phenylalanine into trans-cinnamic acid, a
precursor of a great variety...
Báo cáo Y học: Probing the rotor subunit interface of the ATP synthase from Ilyobacter tartaricus pptx
... for ATP hydrolysis, F
1
converts
the chemical energy of ATP hydrolysis into torque
causing the F
o
motor to act as an ion pump (for
reviews, see [1–4]). Rotation of the asymmetric
Keywords
c ring; ... implications for enzyme regula-
tion. J Biol Chem 279, 35616–35621.
54 Kagawa Y & Racker E (1966) Partial resolution of the
enzymes catalyzing oxidative phosphorylation. X. Cor-
relation o...
Báo cáo y học: "The anti-inflammatory effects of levocetirizine - are they clinically relevant or just an interesting additional effect" pptx
... 5
(page number not for citation purposes)
Allergy, Asthma & Clinical
Immunology
Open Access
Review
The anti-inflammatory effects of levocetirizine - are they clinically
relevant or just an interesting ... has pharmacodynamically and
pharmacokinetically favourable characteristics, including rapid onset of action, high bioavailability,
high affinity for and occupancy of the H1-receptor,...
Báo cáo y học: "Impact of methylphenidate formulation on treatment patterns and hospitalizations: a retrospective analysis" pptx
... attention-deficit/
hyperactivity disorder. Biol Psychiatry 2003, 54:1465-1468.
20. Marks DJ, Newcorn JH, Halperin JM: Comorbidity in Adults with
attention-deficit/hyperactivity disorder. Ann NY Acad Sci ... of the workplace and job satisfaction.
In Ph D thesis U California Berkeley; 2000.
16. Murphy K, Barkley RA: Attention deficit hyperactivity disorder
adults: Comorbidities and adaptive im...
Từ khóa: