Retrovirology Research BioMed Central Open Access HIV-1 latency in actively dividing human T cell docx

... variants used in this study. In the HIV-rtTA variant, the rtTA gene is inserted in place of the nef gene and TetO binding sites are inserted in the HIV-1 promoter. Inactivation of the Tat-TAR ... obtained by muta- tions in the R region and the Tat protein. The shNef expression cassette is inserted in the U3 region. The Tat inactivating mutation (indicted by X) in HIV-rtTA ha...

Ngày tải lên: 13/08/2014, 05:20

... 29 3T cells transfected with either the TAR-D or TAR-WT, but this time we treated the cells with the DNA crosslinking agent Mitomycin C. Upon analysis by flow cytometry, we observed the same trend ... functional. The HIV-1 TAR miRNA causes cells to become resistant to apoptosis in the setting of transfection and infection, and this effect is dependent upon Dicer expression. These data in...

Ngày tải lên: 12/08/2014, 23:20

... and differences in HTLV-1 tax genomic sequences [54]. As a recent report indicated that HTLV-I infection was associ- ated with activated T- cell immunity in Jamaicans but with diminished T- cell immunity in ... with tax mRNA load among HTLV-1 infected individuals in different clinical status To investigate the mutual expression status of HBZ and tax mRNA in different clinical...

Ngày tải lên: 12/08/2014, 23:20

... Env trim- ers would take longer than the time taken to migrate to the fusion site. Another potentially critical factor is that the FP is inserted into the target cell in our assay, but is free in ... recruitment with gp41e added at 13 minutes (i.e. the starting time of Env recruitment) was somewhat less extensive compared to the inhibitor treatment time of 20 minutes. The result is cons...

Ngày tải lên: 12/08/2014, 23:20

... important effect on viral infectivity, and the stud- ies evaluating the effect of CypA inhibitors suggest that at least two distinct cellular activities interacting with the CA protein may be involved. ... 5'- TGCCTCTGACACTGACTAAGAAGATG reverse primer 5'- GGGCTAAGGACTCATTCATTGG Probe 5'- (6-Fam)AAGCTTTTCAACAGCCTTTCTATATCATCGTGTGATA(Tamra) Retrovirology 2009, 6:21 http://www ....

Ngày tải lên: 12/08/2014, 23:20

... selected LVL and HIV+ individuals. LVL patients had a higher percentage of hA3G-type G to A mutations from the total G content in the analyzed sequences than the rest of the infected patients, with ... with high viral set point. Taken together, these studies point to an in vivo HIV neutralizing activity of hA3G. All the above reports were carried out in different patient groups and expe...

Ngày tải lên: 12/08/2014, 23:20

... GGC GCC TGG TCA CC; reverse: CGC TCC TGG AAG ATG GTG ATG G), HIV-1 (HIV-1 forward: TAG TGT GTG CCC GTC TGT T; reverse: CTC TGG TTT CCC TTT CGC TTT C or Gag-reverse: GAT GGT TGT AGC TGT CCC AG ... with proteins involved in mRNA processing [2]. A key factor in this process is the GW182 protein that interacts directly with Argonaute1 (Ago1) [8], and the human homologs of GW182 that int...

Ngày tải lên: 12/08/2014, 23:20

... CAp24) and the tetraspanin web within the infected cell (Fig. 5). It will be of interest to define the exact domain of HIV-1 Gag that interacts with CD81. In fact, in HTLV-1 (another human retrovirus), ... report that in the MOLT /HIV-1 cell line, there is a clustering of the tetraspanins CD63, CD81 and CD82 together with the viral structural proteins Gag and Env. In addition...

Ngày tải lên: 12/08/2014, 23:20

... BLV strains carrying mutations in the genes that encode R3 and G4 accessory proteins [21]. The present results confirm and extend these data with other BLV mutants and reveal that the two routes ... paralleled those of attenuated strains. Altogether these data indicated that a simple quantitative effect distinguishes the circulating proviral loads of leukemogenic from those of attenuated vi...

Ngày tải lên: 12/08/2014, 23:20

... an extra host factor. It is very for- tunate that this factor exhibits very strong anti -HIV-1 activity. It will be very interesting to know whether the expression of this factor is broadly inducible ... restriction in human T cells To further understand the mechanism of HIV-1 restriction in CEM.NKR, we first determined whether CEM.NKR cells secreted a soluble factor that inhibited...

Ngày tải lên: 12/08/2014, 23:20