Retrovirology Research BioMed Central Open Access HIV transfer between CD4 T cells does not doc
... cells to HIV attachment and infection [14]. Therefore, we sough to evaluate whether LFA-1-independ- ent HIV transfer between CD4 T cells might present a dif- ferent target cell selectivity. In this ... infected and uninfected CD4 T cells. The role of adhesion molecules in HIV transfer between CD4 T cells Recently, Jolly et al [8] have suggested that during H...
Ngày tải lên: 13/08/2014, 05:20
... These results suggest that the TAR miRNA is able to decrease levels of apoptosis in stressed cells. To investigate this phenotype in another stress-context, we again used 29 3T cells transfected ... in apoptosis) (Data not shown). These data indicate that the TAR miRNA has the ability to protect cells from stress-induced cell death. Anti-apoptotic effect in infection After observing t...
Ngày tải lên: 12/08/2014, 23:20
... a mutant Tat protein (Tyr26Ala) that is unable to support Tat-mediated transcription [39]. To test this possibility, we also generated SupT1 clones with an integrated HIV- rtTA variant that encodes ... recently demonstrated that miRNAs contrib- ute to latency in resting cells and that activation of the cells by PMA and IL2 reactivates transcription [40]. This activation does not occu...
Ngày tải lên: 13/08/2014, 05:20
Retrovirology Research BioMed Central Open Access Extracellular ATP reduces HIV-1 transfer from potx
... demonstrate that virus replication in autologous CD4 + T cells is not affected upon co-culture with ATP-treated iDCs (Fig. 5). Moreover, ATP treatment resulted in a similar effect on HIV- 1 trans- fer ... the two HIV- 1 attach- ment factors DC-SIGN and MR but at the latest time point tested (i.e. 48 h). Other markers of DC maturation such as CD86 were also increased after ATP exposu...
Ngày tải lên: 13/08/2014, 05:20
Retrovirology Research BioMed Central Open Access Recruitment of HIV-1 envelope occurs subsequent ppt
... recruited to sites of cell contact in the effector dendritic cells [24] and have proposed that contact between the effector and target cells facilitates transmission of HIV- 1 by locally concentrating the ... several Env trim- ers would take longer than the time taken to migrate to the fusion site. Another potentially critical factor is that the FP is inserted into the target cell in o...
Ngày tải lên: 12/08/2014, 23:20
Retrovirology Research BioMed Central Open Access Modulation of HIV-1 infectivity and cyclophilin ppsx
... 5'- TGCCTCTGACACTGACTAAGAAGATG reverse primer 5'- GGGCTAAGGACTCATTCATTGG Probe 5'- (6-Fam)AAGCTTTTCAACAGCCTTTCTATATCATCGTGTGATA(Tamra) Retrovirology 2009, 6:21 http://www .retrovirology. com/content/6/1/21 Page ... an important effect on viral infectivity, and the stud- ies evaluating the effect of CypA inhibitors suggest that at least two distinct cellular activities interac...
Ngày tải lên: 12/08/2014, 23:20
Retrovirology Research BioMed Central Open Access Suppression of HIV-1 replication by microRNA doc
... GTA TTG GGC GCC TGG TCA CC; reverse: CGC TCC TGG AAG ATG GTG ATG G), HIV- 1 (HIV- 1 forward: TAG TGT GTG CCC GTC TGT T; reverse: CTC TGG TTT CCC TTT CGC TTT C or Gag-reverse: GAT GGT TGT AGC TGT ... defects in mRNA export and translation [52-54]. All together, these studies show that HIV- 1 post-integra- tion latency is a multi-factorial process. In the present study, we show that HIV- 1...
Ngày tải lên: 12/08/2014, 23:20
Retrovirology Research BioMed Central Open Access A role for CD81 on the late steps of HIV-1 pdf
... an interacting motif with the adaptor AP-3 protein, is mainly targeted to the endocytic pathway [24] while most of the other tetraspanins are found both at the plasma membrane and in intracellular vesicles ... replication in T lym- phoblastic cells. Further investigations will be needed to reveal the sequential events that lead to TEM formation, cellular factor recruitments and the nature...
Ngày tải lên: 12/08/2014, 23:20
Retrovirology Research BioMed Central Open Access A novel HIV-1 restriction factor that is potx
... express an extra host factor. It is very for- tunate that this factor exhibits very strong anti -HIV- 1 activity. It will be very interesting to know whether the expression of this factor is broadly ... luciferase activities after another 48 hours. Competing interests The authors declare that they have no competing interests. Authors' contributions YH, TZ, and YHZ designed the study. TZ,...
Ngày tải lên: 12/08/2014, 23:20
Retrovirology Research BioMed Central Open Access Distinct efficacy of HIV-1 entry inhibitors to potx
... human trophoblast barrier to study the mother/fetus interface in vitro in direct contact with HIV- 1 infected PBMCs [4,33] that we used in the present study. To anticipate the future by evaluating ... LAI. The figure shows a dose-dependent inhibition of the inter- action between BeWo -CD4 negative target cells and CD4+ T cells infected with HIV- 1/LAI. Retrovirology 2008, 5:31...
Ngày tải lên: 13/08/2014, 05:20