Báo cáo khoa học: "Tight glycaemic control: a prospective ob

Tài liệu Báo cáo khoa học: Local stability identiﬁcation and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

... FEBS Local stability identiﬁcation and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding Zhengding Su 3 , Jiun-Ming Wu 1 , Huey-Jen Fang 1 , Tian-Yow Tsong 2,3 and ... state may be maintained mainly by key amino acids. In this study, two point-mutated proteins each with a single base substitution [alanine for trypto...

Ngày tải lên : 20/02/2014, 01:20

7
551
0

Báo cáo khoa học: Evolutionary changes to transthyretin: structure and function of a transthyretin-like ancestral protein doc

... hydantoinase, allantoinase and dihydrooratase [32]. Cyclic amidohydrolases share a number of physicochemical characteristics. These characteristics include quaternary, tertiary, secondary and ... decarboxyl- ation of OHCU to (S)-allantoin. Thus, the pathway of the conversion of uric acid to (S)-allantoin via the three enzymes uricase, TLP (5-HIUase) and OHCU decar- boxylas...

Ngày tải lên : 07/03/2014, 00:20

13
390
0

Báo cáo khoa học: Exosites mediate the anti-inﬂammatory effects of a multifunctional serpin from the saliva of the tick Ixodes ricinus potx

... 2009 The Authors Journal compilation ê 2009 FEBS Exosites mediate the anti-inﬂammatory effects of a multifunctional serpin from the saliva of the tick Ixodes ricinus Pierre-Paul Prevot 1 , Alain ... 87–111. 13 Iwanaga S, Okada M, Isawa H, Morita A, Yuda M & Chinzei Y (2003) Identiﬁcation and characterization of novel salivary thrombin inhibitors fr...

Ngày tải lên : 07/03/2014, 01:20

12
499
0

Báo cáo khoa học: Functional characterization and Me2+ ion speciﬁcity of a Ca2+–citrate transporter from Enterococcus faecalis1 pdf

... Microbiologı ´ a, Facultad de Ciencias Bioquı ´ micas y Farmace ´ uticas, Universidad Nacional de Rosario, Argentina Analysis of a large set of bacterial genomes has shown that, in spite of its high abundance ... cations Ca 2+ ,Ba 2+ ,Sr 2+ ,Zn 2+ ,Ni 2+ ,Mg 2+ ,Mn 2+ and Co 2+ were added at a ﬁnal concentration of 2 mM, and Cu 2+ ,Cd 2+ and Pb 2+ were added at a ﬁnal con...

Ngày tải lên : 23/03/2014, 10:20

10
386
0

Báo cáo khoa học: Odorant binding protein has the biochemical properties of a scavenger for 4-hydroxy-2-nonenal in mammalian nasal mucosa doc

... binding protein has the biochemical properties of a scavenger for 4-hydroxy-2-nonenal in mammalian nasal mucosa Stefano Grolli, Elisa Merli, Virna Conti, Erika Scaltriti and Roberto Ramoni Dipartimento ... incubation with a rabbit serum raised against HNE protein adducts. Ligand- binding tests showing the functionality of the same HNE-treated porcine (...

Ngày tải lên : 23/03/2014, 10:20

12
386
0

Báo cáo khoa học: Growth hormone/JAK-STAT axis signal-transduction defect A novel treatable cause of growth failure pdf

... Authors Journal compilation ª 2006 FEBS Growth hormone/JAK-STAT axis signal-transduction defect A novel treatable cause of growth failure Andrea P. Rojas-Gil 1 , Panos G. Ziros 2 , Leonor Diaz 2 , ... Takahashi Y, Shirono H, Arisaka O, Takahashi K, Yagi T, Koga J, Kaji H, Okimura Y, Abe H, Tanaka T & Chihara K (1997) Biologically inactive growth hormone caused...

Ngày tải lên : 23/03/2014, 10:21

13
323
0

Báo cáo khoa học: The Promyelocytic Leukemia Zinc Finger (PLZF ) gene is a novel transcriptional target of the CCAAT-DisplacementProtein (CUX1) repressor ppt

... (5Â-gaaaggcatcccgaacgcat-3 ); Chip2up primer (5Â-aaatgtcttgaccagccgtc-3 ) and Chip2dw primer (5Â-gaaacaaaggcctctcccag-3 ); Chip3up primer (5Â-gctttgcagt- cagaatggtc-3 ) and Chip3dw primer (5Â-ctgagcactgactac- gaaac-3 ). ... gene is a novel transcriptional target of the CCAAT-Displacement- Protein (CUX 1) repressor Isabelle Fre ´ chette, Mathieu Darsigny, Karin...

Ngày tải lên : 29/03/2014, 21:20

13
359
0

Báo cáo khoa học: "From RAGS to RICHES: exploiting the potential of a ﬂexible generation architecture" pot

... REND and SF that they can start pro- cessing. LC then goes into a second phase, in- the same ideals. In addition, we aim to test the claims that the RAGS data model approach sup- ports the flexible ... identifier and a type, and From RAGS to RICHES: exploiting the potential of a flexible generation architecture Lynne Cahill , John Carroll , Roger Evans...

Ngày tải lên : 31/03/2014, 04:20

8
368
0

Báo cáo khoa học: Biotinylation in the hyperthermophile Aquifex aeolicus Isolation of a cross-linked BPL:BCCP complex pptx

... underlining and mutagenic changes are shown in bold). BPL-for, 5Â-TTCTTAA CCATGG GCTTCAAAAACCTGAT-CTGG-3Â;BPL-rev,5Â-TTAA GGATCCTAAGAACGAGACAGGCTGAACTCTCC-3Â; BCCPD67, 5Â-GTAA CCATGGGTGAACAGGAAGA A- 3Â;BCCP-rev,5Â- GGATCCTTAAACGTTTGTGTC TATAAG-3Â; ... BirA [19]. In E. coli, we have expressed active A. aeolicus BPL, the biotin-binding domain of A. aeolicus BCCP as a His 6 N-te...

Ngày tải lên : 31/03/2014, 07:20

11
578
0

Báo cáo khoa học: "Consequential late effects after radiotherapy for prostate cancer - a prospective longitudinal quality of life study" pps

... 5:27 http://www.ro-journal.com/content/5/1/27 Page 7 of 9 RESEARC H Open Access Consequential late effects after radiotherapy for prostate cancer - a prospective longitudinal quality of life study Michael Pinkawa * , ... J Radiat Oncol Biol Phys 2005, 63:15 0-1 54. doi:10.1186/174 8-7 17X- 5-2 7 Cite this article as: Pinkawa et al.: Consequential late...

Ngày tải lên : 09/08/2014, 08:23

9
303
0

Báo cáo khoa học: " Erythropoietin response in critically ill mechanically ventilated patients: a prospective observational study" pot

... outcomes in mechanically ventilated patients has been reported. Further study of therapies directed at treating anemia of critical illness and determining its potential impact on mechanical ventilation outcomes ... ventilated patient is blunted. ã Further investigation of therapies directed at anemia of critically ill mechanically ventilated patients are neces- sary to determi...

Ngày tải lên : 12/08/2014, 22:21

5
213
0

Báo cáo khoa học: "Tight glycaemic control: a prospective observational study of a computerised decision-supported intensive insulin therapy protocol'''' pptx

... approximately 10% of the variability on univariate analysis. ã BMI and APACHE II score explained 27% of the variability in multivariate analysis. The following Additional files are available ... the variability explained). There was a sug- gestion that females had better TGC than males, by an aver- age of 7.1%. Age did not appear to explain variability in TGC. In the multivariate...

Ngày tải lên : 13/08/2014, 03:21

10
275
0

Báo cáo y học: "Tight glycaemic control: intelligent technology or a nurse-wise strategy" potx

Ngày tải lên : 13/08/2014, 08:20

1
143
0

Báo cáo y học: "Tight glycaemic control in the intensive care unit: pitfalls in the testing of the concept" docx

... after having recruited 6,100 patients [5]. Third, further aggravating the problem of power, the study turned out to realize intensive insulin therapy, but without tight glycaemic control. The median ... Bouillon R: Intensive insulin therapy in the medical ICU. N Engl J Med 2006, 354:449-461. 4. Krinsley JS: Effect of an intensive glucose management protocol on the m...

Ngày tải lên : 13/08/2014, 11:23

2
243
0

Báo cáo y học: "Correction: Gastrointestinal Failure score in critically ill patients: a prospective observational study" potx

... intolerance; IAH, intra-abdominal hypertension; IAP, intra-abdominal pressure; ICU, intensive care unit; MAP, mean arterial pressure; MV, mechanical ventilation; PEEP, positive end-expiratory ... [37.7] 0.002 The values are presented as mean ± standard deviation, if not stated otherwise. APACHE, Acute Physiology and Chronic Health Evaluation; BMI, body mass index; CVP, central venous pressure...

Ngày tải lên : 13/08/2014, 11:23

2
333
0

Báo cáo khoa học: "Tight glycaemic control: a prospective observational study of a computerised decision-supported intensive insulin therapy protocol'''''''' pptx

Tài liệu Báo cáo khoa học: Local stability identiﬁcation and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

Báo cáo khoa học: Evolutionary changes to transthyretin: structure and function of a transthyretin-like ancestral protein doc