Báo cáo khoa học: " Cytokine profiles as markers of disease severity in sepsis: a multiplex analysis" pot

Báo cáo khoa học: "Ovular secretions as part of pollination mechanisms in conifer" doc

Báo cáo khoa học: "Ovular secretions as part of pollination mechanisms in conifer" doc

... cells. In Cephalotaxus drupacea, five amino acids were isolated – proline, asparagine, glutamate, alanine and serine [55]. The amino acids found in Thuja were: serine, glycine, alanine and glutamate ... secretion Cycas revoluta Cycadaceae pollination drop Ginkgo biloba Ginkgoaceae pollination drop Pinus nigra Pinaceae pollination drop Abies grandis Pinaceae no drop Tsuga heterophylla Pina...

Ngày tải lên: 08/08/2014, 14:20

13 323 0
báo cáo khoa học: " Paradoxical embolism following thromboaspiration of an arteriovenous fistula thrombosis: a case report" pot

báo cáo khoa học: " Paradoxical embolism following thromboaspiration of an arteriovenous fistula thrombosis: a case report" pot

... following thromboaspiration of an arteriovenous fistula thrombosis: a case report Bouteina Bentaarit 1 , Anne Marie Duval 2 , Anne Maraval 3 , Djamal Dahmane 1 , Karine Dahan 1 , Brahim Amara 1 , Philippe ... (Orgaran) was reinitiated. A tunneled silicone catheter was inserted in the right femoral vein. A revascularization procedure by angioplasty and stent deployment was attempted...

Ngày tải lên: 11/08/2014, 02:21

5 373 0
Báo cáo khoa học: " Expert opinion as ''''validation'''' of risk assessment applied to calf welfare" ppt

Báo cáo khoa học: " Expert opinion as ''''validation'''' of risk assessment applied to calf welfare" ppt

... specified using a matrix of welfare-relevant attributes covering the range of conditions prevailing in the housing systems in the assessment domain, including both environment- based inputs and animal-based ... that view, but also recognizes that an assessment of animal welfare is always an assessment from a human's point of view [23]. It is rarely possible to assess over...

Ngày tải lên: 12/08/2014, 18:22

12 217 0
Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

... following primers: F133N-fw (5¢-GATTTTTGTGGCT GGAACAGGA AACCCATATTTTACAACTGATTCG) and F133N-rv (5¢-CGAATCAGTTGTAAAATATGG GT TTCCTGTTCCAGCCACAAAAAT), with the altered nucleotides shown in bold and ... Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target Louise Egeblad-Welin 1 , Martin Welin 2, *, Liya Wang 1 and Staffan Eriksson...

Ngày tải lên: 18/02/2014, 16:20

12 657 0
Báo cáo khoa học: Flexible nets The roles of intrinsic disorder in protein interaction networks potx

Báo cáo khoa học: Flexible nets The roles of intrinsic disorder in protein interaction networks potx

... orientations relative to the binding target surface. Additionally, the flexible hinge facilitates variable separation of the two globular domains after binding has occurred, again allowing for binding ... regions of the protein involved in interaction with Cdk2 and cyclin A: 1, domain 1 interacting with cyclin A; 2, a linker helix involved in binding both cyclin A and Cdk2; 3, do...

Ngày tải lên: 07/03/2014, 21:20

20 401 0
Báo cáo khoa học: Identification and characterization of oxidized human serum albumin A slight structural change impairs its ligand-binding and antioxidant functions pptx

Báo cáo khoa học: Identification and characterization of oxidized human serum albumin A slight structural change impairs its ligand-binding and antioxidant functions pptx

... Yamada 2 , Uno Tagami 2 , Kenji Takehana 1 , Ichiro Sonaka 1 , Eiichiro Suzuki 2 and Kazuo Hirayama 2 1 Pharmaceutical Research Laboratories, Ajinomoto Co. Inc., Kawasaki, Japan 2 Institute of ... form of human serum albumin in patients with diabetes mellitus. Diabetes Res Clin Pract 18, 153–158. 9 Soejima A, Matsuzawa N, Hayashi T, Kimura R, Ootsuka T, Fukuoka K, Yamada A, Nagasawa T...

Ngày tải lên: 16/03/2014, 13:20

12 479 0
Báo cáo khoa học: Modeling the Qo site of crop pathogens in Saccharomyces cerevisiae cytochrome b ppt

Báo cáo khoa học: Modeling the Qo site of crop pathogens in Saccharomyces cerevisiae cytochrome b ppt

... residues are in bold. The sequences of E. graminis, V. inaequalis and P. megasperma are available from the EMBL database. The sequence of S. fuliginea was determined by targeted RT-PCR amplification as ... basidiomycete Mycena galopoda [2]. In E. graminis, the mutation G14 3A has spread widely and is without any apparent fitness penalty. In other pathogens, such as V. inaequalis,...

Ngày tải lên: 16/03/2014, 16:20

8 345 0
Báo cáo khoa học: "On the Computational Complexity of Dominance Links in Grammatical Formalisms" doc

Báo cáo khoa học: "On the Computational Complexity of Dominance Links in Grammatical Formalisms" doc

... and Makoto Kanazawa. 2005. The complexity and generative capacity of lexicalized abstract categorial grammars. In Philippe Blache, Edward Stabler, Joan Busquets, and Richard Moot, editors, LACL’05, ... exponential lin- ear logic (de Groote et al., 2004), • emptiness and membership of abstract cat- egorial grammars (de Groote et al., 2004; Yoshinaka and Kanazawa, 2005), • emptiness and m...

Ngày tải lên: 16/03/2014, 23:20

11 400 0
Báo cáo khoa học: "Re-evaluating the Role of B LEU in Machine Translation Research" ppt

Báo cáo khoa học: "Re-evaluating the Role of B LEU in Machine Translation Research" ppt

... offending en- try was unusual in that it was not fully automatic machine translation; instead the entry was aided by monolingual English speakers selecting among alternative automatic translations ... Florida 3-grams: American plane that, American plane which, Miami , Florida, Miami in Florida, Orejuela appeared calm, Orejuela seemed quite, appeared calm as, appeared calm while, as he...

Ngày tải lên: 17/03/2014, 22:20

8 455 0
Báo cáo khoa học: Identification and characterization of important residues in the catalytic mechanism of CMP-Neu5Ac synthetase from Neisseria meningitidis potx

Báo cáo khoa học: Identification and characterization of important residues in the catalytic mechanism of CMP-Neu5Ac synthetase from Neisseria meningitidis potx

... substrate discrimination or in forming the binding site for AB CD Gln96 Asp98 Asp225 Gln104 Asp209 Asp211 Gln141 Asp245 Asp247 Gln98 Asp100 Asp235 Fig. 3. Metal-binding residues of CNS and related ... than that measured for a number of other bacterial CNS enzymes. However, we note that our assay was a con- tinuous enzyme assay rather than the discontinuous assays often used in the...

Ngày tải lên: 22/03/2014, 21:21

12 463 0
Từ khóa:
w