Báo cáo khoa học: "The concentration of oxygen, lactate and glucose in the central veins, right heart, and pulmonary artery: a study in patients with pulmonary hypertension" ppt

Báo cáo khoa học: Dual role of oxygen during lipoxygenase reactions potx

... model to the varioussets of experimental data was determined by the coefﬁcient of determination B being the ratio of the explained variation of the data to the total variation. For linear regressionmodels, ... containing variableconcentrations of substrate fatty acids and ⁄ or oxygen(total assay volume 1 mL). The enzyme was preincubated in the assay buffer for % 10 s and then the reaction wasstarted ... the absorbance at 275 nm during the time course of the reaction. From Fig. 6Aa it can beseen that there was a linear increase in absorbance at275 nm and subsequent HPLC analysis indicated the formation...

Báo cáo khoa học: Solution structure of long neurotoxin NTX-1 from the venom of Naja naja oxiana by 2D-NMR spectroscopy pot

... deletion of Pro9, and substitution of Asp63 with Asn.Materials and methodsSample preparation and puriﬁcation Central Asian cobra ( Naja naja oxiana) s nakes werecollected, m ilked and the pooled ... that long neurotoxins are capable of binding to a7 -neuronal as well as muscular AChR [38]. The results from mutational a nalysis of a- cobratox in (a- CTX) indicate that replacement of at least ... and aminoacid sequences o f the toxin Laticauda semifasciata II I, a weak a ndreversibly acting neurotoxin from venom of a sea snake, Laticaudasemifasciata. Biochem. J. 141, 389–400.37. Scarselli,...

Tài liệu Báo cáo khoa học: Transient silencing of Plasmodium falciparum bifunctional glucose-6-phosphate dehydrogenase) 6-phosphogluconolactonase docx

... CGCGCCTACTTTTTACTGGGATTCTATGGGACCTGGCGCGPfG6PD-6PGL (X74988) GAACTCCAGGAAAAACAAGTCAAG TTTTGACAAGTCCAAATACCTCTTT CGGCCAACGTTAAAAAGTATCGGATGGAATTTTGGCCGPfGPx (PFL0595C) AATTGTGATTCGATGCATGATG TTTATCGACGAGAAATTTTCCAA ... CGGGCAGCAAGGCATAACGCAAGCCCGPfTrxR (AL929357) TTGTACTAATATTCCTTCAATATTTGCTG GCCACGGGCGCTAATT CCGGGCTGTAGGAGACGTAGCTGAAAATGTCCCGGPfSOD (PF08–0071) CAACGCTGCTCAAATATGGA CATGAGGCTCACCACCACA CGCGCCTACTTTTTACTGGGATTCTATGGGACCTGGCGCGPfG6PD-6PGL ... Molecular Beacon (5¢-to3¢)Pf18srRNA (M19172) TGACTACGTCCCTGCCCTT ACAATTCATCATATCTTTCAATCGG GGGGGACACCGCCCGTCGCTCCCCCPfGR (NC_004317) AGTGGAGGAATGGCTGCAG CCTAAACGGGATTTTTCGACA CGGGCAGCAAGGCATAACGCAAGCCCGPfTrxR...

Báo cáo khoa học: Functional site of endogenous phospholipase A2 inhibitor from python serum Phospholipase A2 binding and anti-in¯ammatory activity ppt

... A. 31. Yamakawa, M., Nozaki, M. & Hokama, Z. (1976) Fractionation of Sakishmma-habu (Trimeresurus elegans) venom and lethalhemorrhage and oedema f orming activity of the fractions. In Animal, ... Chan2 and Ponnampalam Gopalakrishnakone1Venom and Toxin Research Programme, Departments of 1Anatomy and 2Surgery, Faculty of Medicine,National University of Singapore, Singapore The functional s ... perito-neal adhesions in male Sprague±Dawley rats (250±320 g ).Under light ether anesthesia and by means of a midlinelaparotomy incision, a ventral abdominal defect(15 ´ 25 mm) was created in each...

Báo cáo khoa học: "The concentration of oxygen, lactate and glucose in the central veins, right heart, and pulmonary artery: a study in patients with pulmonary hypertension" ppt

... for citation purposes)Vol 11 No 2Research The concentration of oxygen, lactate and glucose in the central veins, right heart, and pulmonary artery: a study in patients with pulmonary hypertensionGuillermo ... lactate concentration at the various sampling sitesOxygen saturation and lactate concentration at the various sampling sites. Nine patients were included. Values are expressed as mean ± standard ... development of Δ[Lac]. The finding of greater SO2 and [Lac] in IVC and SVC than in pulmonary artery indicates that further dilution of oxygen and [Lac] takes place as blood flows through the right heart...

Tài liệu Báo cáo khoa học: Reversible tetramerization of human TK1 to the high catalytic efﬁcient form is induced by pyrophosphate, in addition to tripolyphosphates, or high enzyme concentration ppt

... the a and b phosphate groups in the nucleotide ADP. On the other hand, the large difference in phosphate donorcapacity, only 4% with ADP and no activity with NaPPP and NaPP, indicates that the ... properties of hTK1 may be importantfor maintaining a balanced supply of the DNA precur-sor. This underlines the importance of elucidating the molecular and structural background of the enzymatic and ... effect of AMP in the assay. The average mass of the eight tetrameric hTK1s was estimated as103.7 ± 3.2 (SEM) kDa (Table 1).Are the oligomerization pattern and kineticsrelated? The kinetics of...

Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen afﬁnities of the a and b subunits potx

... Protein (20 lM in heme) at 2.0 M NaCl.Fig. 4. The parameters of O2binding to the a and b subunits within liganded hemoglobin as a function of NaCl concentration. Bars 1, 2 and 3 are the relative ... and NaCl on the bimolecularassociation rate constant of O2rebinding and the quantum yield of BR for the a and b subunits within the liganded dimer and tetramer of hemoglobin weredetermined. ... DAnormis a normalized change in optical density of the sample and a a, a b, k¢ a and k¢bare the ampli-tudes and rate constants of BR. The quantity [O2]is the concentration of molecular oxygen...

Báo cáo khoa học: Structural characterization of photosystem II complex from red alga Porphyridium cruentum retaining extrinsic subunits of the oxygen-evolving complex docx

... proteins (i.e. the 33 kDa, cyt c550 and 12 kDa protein) and phycobilisomes as antennae in red algae instead of the 23 and 16 kDa proteins and LHCII complex found in greenalgae and higher plant ... dispersedparticles with uniform size and shape and i s almost free of contaminants.To process the particle images by single p article a nalysis, a large data set was extracted from the images and the projections ... membranes of red algae are not differentiatedinto stacked and unstacked regions as fou nd in higher plants and g reen algae [1,2]. Both cyanobacteria and the red algaecontain phycobilisomes that...

Báo cáo khoa học: "Circadian pattern of activation of the medical emergency team in a teaching hospita"

... conceived the study, constructed the data base, and was the principle author of the manuscript. SB, DG, and SWassisted with construction of the data base. HO, GG, and RBcontributed with the study ... communicated by the switchboard operatorsthrough the hospital loudspeakers and paging system, and a detailed log of all calls is maintained.Criteria for medical emergency team activationCalling ... this to aspects of nursing and medicaldaily routine.Materials and methods The hospitalAustin Health is a university-affiliated teaching hospital with three hospital campuses situated in Melbourne,...

Tài liệu Báo cáo khoa học:Tyrosine phosphorylation of tau regulates its interactions with Fyn SH2 domains, but not SH3 domains, altering the cellular localization of tau ppt

... pervanadate-treatedcells with an antibody against total tau revealeddecreased electrophoretic mobility of tau, with the appearance of an  68-kDa tau species in wild-type and all of the mutant ... motif in tau plays animportant role in mediating the interaction of tau with Fyn-SH3. We alsoshow that tau interacts with the SH2 domain of Fyn, and that this associa-tion, unlike that of Fyn-SH3, ... previous ﬁndings that pervanadate treat-ment increased the association of wild-type tau with GST–Fyn-SH2. In addition, although a 64-kDa YallFtau band was apparent in lysates from cells cotrans-fected...

Xem thêm