Báo cáo khoa học: "The concentration of oxygen, lactate and glucose in the central veins, right heart, and pulmonary artery: a study in patients with pulmonary hypertension" ppt

... model to the various sets of experimental data was determined by the coefficient of determination B being the ratio of the explained variation of the data to the total variation. For linear regression models, ... containing variable concentrations of substrate fatty acids and ⁄ or oxygen (total assay volume 1 mL). The enzyme was preincubated in the assay buffer fo...

Ngày tải lên: 16/03/2014, 19:20

... deletion of Pro9, and substitution of Asp63 with Asn. Materials and methods Sample preparation and purification Central Asian cobra ( Naja naja oxiana) s nakes were collected, m ilked and the pooled ... that long neurotoxins are capable of binding to a7 -neuronal as well as muscular AChR [38]. The results from mutational a nalysis of a- cobratox in (a- CTX) indica...

Ngày tải lên: 23/03/2014, 13:20

... CGCGCCTACTTTTTACTGGGATTCTATGGGACCTGGCGCG PfG6PD-6PGL (X74988) GAACTCCAGGAAAAACAAGTCAAG TTTTGACAAGTCCAAATACCTCTTT CGGCCAACGTTAAAAAGTATCGGATGGAATTTTGGCCG PfGPx (PFL0595C) AATTGTGATTCGATGCATGATG TTTATCGACGAGAAATTTTCCAA ... CGGGCAGCAAGGCATAACGCAAGCCCG PfTrxR (AL929357) TTGTACTAATATTCCTTCAATATTTGCTG GCCACGGGCGCTAATT CCGGGCTGTAGGAGACGTAGCTGAAAATGTCCCGG PfSOD (PF08–0071) CAACGCTGCTCAAATATGGA CATGAGG...

Ngày tải lên: 19/02/2014, 07:20

... A. 31. Yamakawa, M., Nozaki, M. & Hokama, Z. (1976) Fractionation of Sakishmma-habu (Trimeresurus elegans) venom and lethal hemorrhage and oedema f orming activity of the fractions. In Animal, ... Chan 2 and Ponnampalam Gopalakrishnakone 1 Venom and Toxin Research Programme, Departments of 1 Anatomy and 2 Surgery, Faculty of Medicine, National University of Singa...

Ngày tải lên: 23/03/2014, 21:21

... for citation purposes) Vol 11 No 2 Research The concentration of oxygen, lactate and glucose in the central veins, right heart, and pulmonary artery: a study in patients with pulmonary hypertension Guillermo ... lactate concentration at the various sampling sitesOxygen saturation and lactate concentration at the various sampling sites...

Ngày tải lên: 13/08/2014, 03:20

... the a and b phosphate groups in the nucleotide ADP. On the other hand, the large difference in phosphate donor capacity, only 4% with ADP and no activity with NaPPP and NaPP, indicates that the ... properties of hTK1 may be important for maintaining a balanced supply of the DNA precur- sor. This underlines the importance of elucidating the molecular an...

Ngày tải lên: 18/02/2014, 12:20

... Protein (20 l M in heme) at 2.0 M NaCl. Fig. 4. The parameters of O 2 binding to the a and b subunits within liganded hemoglobin as a function of NaCl concentration. Bars 1, 2 and 3 are the relative ... and NaCl on the bimolecular association rate constant of O 2 rebinding and the quantum yield of BR for the a and b subunits within the liganded dimer...

Ngày tải lên: 16/03/2014, 14:20

... proteins (i.e. the 33 kDa, cyt c 550 and 12 kDa protein) and phycobilisomes as antennae in red algae instead of the 23 and 16 kDa proteins and LHCII complex found in green algae and higher plant ... dispersed particles with uniform size and shape and i s almost free of contaminants. To process the particle images by single p article a nalysis, a large data se...

Ngày tải lên: 16/03/2014, 18:20

... conceived the study, constructed the data base, and was the principle author of the manuscript. SB, DG, and SW assisted with construction of the data base. HO, GG, and RB contributed with the study ... communicated by the switchboard operators through the hospital loudspeakers and paging system, and a detailed log of all calls is maintained. Criteria f...

Ngày tải lên: 25/10/2012, 10:45

... pervanadate-treated cells with an antibody against total tau revealed decreased electrophoretic mobility of tau, with the appearance of an  68-kDa tau species in wild-type and all of the mutant ... motif in tau plays an important role in mediating the interaction of tau with Fyn-SH3. We also show that tau interacts with the SH2 domain of Fyn, and that this...

Ngày tải lên: 14/02/2014, 14:20