Báo cáo khoa học: "Blood glucose measurements in the critically ill: more than just a blood draw" doc
Báo cáo khoa học: "Blood glucose measurements in the critically ill: more than just a blood draw" doc
... Corstjens andcolleagues [1], yields glucose results dependent on hemato-Commentary Blood glucose measurements in the critically ill: more than just a blood drawFrank M Brunkhorst1and Hans G Wahl21Department ... While data about the beneficial effects ofnormoglycemia in critically ill patients are conflicting andinconsistent [2,3], there is no doubt about the importance ofaccurate glucose measurements ... Page 1 of 2(page number not for citation purposes)Available online http://ccforum.com/content/10/6/178Abstract A crucial determinant for the success of intensive insulin therapy in critically...
- 2
- 262
- 0
Báo cáo khoa học: "Kidney function assessment in the critically ill child: is it time to leave creatinine behind" pot
... especiallyproblematic in critically ill patients in whom renal function is in anunsteady state, rendering creatinine-based baseline assessmentmeasures of renal function potentially inadequate. Herrero-Morinand ... demonstrating that even small increases in serumcreatinine are associated with increases in patient morbidityand mortality. Chertow found a 6.5-fold increase in the oddsof death for patients ... Initiative [4].Hoste and colleagues validated the RIFLE criteria in critically ill adult patients, finding that patients with maximum RIFLEclass R, class I and class F had hospital mortality rates...
- 2
- 264
- 0
Báo cáo khoa học: Requirement for asparagine in the aquaporin NPA sequence signature motifs for cation exclusion docx
... ions.DiscussionVarious statistical analyses of data from protein struc-ture databases have ranked the 20 proteinogenic aminoacids according to their frequency at N-terminal helixcaps [24–27]. Accordingly, mainly ... function [28,29]. The branching next to the car-bon atom carrying the amino group may clash with the dense packing in the NPA protein region. Putting anAla at the Ncapposition produced ambiguous ... diameter in the NPA region by about 20% of the average diameterof the remaining channel, leaving the ar⁄ R regionaround Arg189 as the only constriction in the channelpath. Ser186 may form two stabilizing...
- 9
- 341
- 0
báo cáo khoa học: " Recurrent takotsubo cardiomyopathy in the setting of transient neurological symptoms: a case report" pptx
... with a takotsubo-likestate is often seen with intracranial pathology, includ ingsubarachnoid hemorrhage and congenital brain abnorm-alities in children. In the setting of intracranial injury ... takotsubo cardiomyopathy in the setting of transient neurological symptoms: a case reportMuhammad Rizwan Sardar1, Catherine Kuntz2, Jeremy A Mazurek3*, Naveed Hassan Akhtar4, Wajeeha ... with a LVEF of 25% and a possible apical thrombus(Figure 1A) . Cardiac catheterization was planned toassess whether the patient had acute CHF secondary topossible acute myocardial infarction. The...
- 4
- 357
- 0
Báo cáo khoa học: " Role of iron in anaemic critically ill patients: it’s time to investigate" pps
... iron. In fact, in just a few hours, proinflammatory and anti-inflammatory cytokinescause a decrease in the iron level in blood. Proinflammatory cytokines such as tumour necrosis factor-α,IL-1β and ... Central LtdSee Review, page 356AbstractAnaemia is a common problem in critically ill patients admitted to intensive care units. Many factorscan be involved in its development, including rapid ... and mortalityworldwide and is often observed in critically ill patients, not just at admission but particularly during intensive care unit(ICU) stay [1]. The time course of anaemia during an...
- 2
- 247
- 0
Báo cáo khoa học: " Is albumin administration in the acutely ill associated with increased mortality? Results of the SOAP study" pps
... regression analysis with albumin administration as the dependent factor. a On the day of onset of albumin administration in the albumin group and on admission in other patients. bAt any time during ... plus at least oneorgan failure. Mean fluid balance was calculated as the totalfluid balance during the ICU stay divided by the duration ofICU stay in days.Statistical methodsData were analyzed ... Universitario Rio Hortega of Valladolid (C Alde-coa Alvarez-Santullano); Sabadell Hospital (A Artigas); Hospital Clinic of Barcelona (E Zavala, A Escorsell, J Nicolas); Virgen del Camino of Pamplona...
- 10
- 313
- 0
Báo cáo khoa học: "Etomidate, pharmacological adrenalectomy and the critically ill: a matter of vital importance" pps
... iseducational, in that we need to inform anaesthetic andEmergency Department colleagues regarding currentevidence in the critical care literature.There are also implications for clinical researchers. ... partial, as many critically ill patientsare intubated by other practitioners [13]. This poses twoproblems. The first is that clinical and intensive carephysicians need to be aware that other ... translates into a numberneeded to treat of five patients. The early advantage ofrelative haemodynamic stability at intubation, which itself isnot an important patient-centred outcome and can...
- 2
- 235
- 0
Báo cáo khoa học: " Oestrone Sulphate Measurements for the Prediction of Small or Large Litters in Pigs" doc
... Lan-drace × Duroc boars, used on the day ofcollection or the day after. All the sows and giltshad been heat tested with a boar also if theywere inseminated artificially. Insemination wasalso ... performed adjacent to a boar. All the sowsincluded had a weaning to service interval of 4or 5 days. Parity ranged from 1 to 5. Parity and the number of AI or matings wererecorded and included in the ... 1992).Furthermore, the value of analysing a single blood sample for prediction of litter size at far-rowing has been debated (Hattersley et al.1980, Atkinson et al. 1986), whereas specifying the interval...
- 8
- 265
- 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc
... TCTTTGACTTCTCAAACTGATCGRPE6 5a- His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTCTTGAACACY. Takahashi ... GCGGCCGCCACCATGGTCAGCCGTTTTGAACACRPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAGRPE65c-FwdNM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACACRPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAGRPE6 5a GSP-FwdNM_200751 TGGGGAGGACTTTTATGCTGTRPE6 5a ... RNA was extracted from the eyecups usingTrizol reagent (Invitrogen, Carlsbad, CA, USA) and furtherpurified by an RNeasy kit (Qiagen, Valencia, CA, USA). The cDNA was synthesized using the TaqMan...
- 14
- 753
- 0
Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf
... expression in female hearts indicates thatmyocardial glucose metabolism may be increased in parallel. As optimization of glucose metabolism isincreasingly highlighted as a therapeutic interventionfor ... 3B). Again, these changes were abol-ished in female db ⁄ db heart mitochondria. Together,these data suggest that the greater reliance of femalemurine cardiac mitochondria on glucose than on fattyacids ... ischemia-induced and ischemia–reperfusion-inducedcardiac damage [7], our data provide a novel mecha-nism for how signaling cascades induce transcriptionalpathways to augment glucose- mediated cardioprotec-tion...
- 7
- 582
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ