Báo cáo khoa học: "Blood glucose measurements in the critically ill: more than just a blood draw" doc

Báo cáo khoa học: "Blood glucose measurements in the critically ill: more than just a blood draw" doc

Báo cáo khoa học: "Blood glucose measurements in the critically ill: more than just a blood draw" doc

... Corstjens and colleagues [1], yields glucose results dependent on hemato- Commentary Blood glucose measurements in the critically ill: more than just a blood draw Frank M Brunkhorst 1 and Hans G Wahl 2 1 Department ... While data about the beneficial effects of normoglycemia in critically ill patients are conflicting and inconsistent [2,3], there is no doubt ab...

Ngày tải lên: 13/08/2014, 03:20

2 263 0
Báo cáo khoa học: "Kidney function assessment in the critically ill child: is it time to leave creatinine behind" pot

Báo cáo khoa học: "Kidney function assessment in the critically ill child: is it time to leave creatinine behind" pot

... especially problematic in critically ill patients in whom renal function is in an unsteady state, rendering creatinine-based baseline assessment measures of renal function potentially inadequate. Herrero-Morin and ... demonstrating that even small increases in serum creatinine are associated with increases in patient morbidity and mortality. Chertow found a 6.5-fold increase in...

Ngày tải lên: 13/08/2014, 03:21

2 264 0
Báo cáo khoa học: Requirement for asparagine in the aquaporin NPA sequence signature motifs for cation exclusion docx

Báo cáo khoa học: Requirement for asparagine in the aquaporin NPA sequence signature motifs for cation exclusion docx

... ions. Discussion Various statistical analyses of data from protein struc- ture databases have ranked the 20 proteinogenic amino acids according to their frequency at N-terminal helix caps [24–27]. Accordingly, mainly ... function [28,29]. The branching next to the car- bon atom carrying the amino group may clash with the dense packing in the NPA protein region. Putting an Ala at...

Ngày tải lên: 15/03/2014, 00:20

9 341 0
báo cáo khoa học: " Recurrent takotsubo cardiomyopathy in the setting of transient neurological symptoms: a case report" pptx

báo cáo khoa học: " Recurrent takotsubo cardiomyopathy in the setting of transient neurological symptoms: a case report" pptx

... with a takotsubo-like state is often seen with intracranial pathology, includ ing subarachnoid hemorrhage and congenital brain abnorm- alities in children. In the setting of intracranial injury ... takotsubo cardiomyopathy in the setting of transient neurological symptoms: a case report Muhammad Rizwan Sardar 1 , Catherine Kuntz 2 , Jeremy A Mazurek 3* , Naveed Hassan Akhtar 4...

Ngày tải lên: 10/08/2014, 23:20

4 357 0
Báo cáo khoa học: " Role of iron in anaemic critically ill patients: it’s time to investigate" pps

Báo cáo khoa học: " Role of iron in anaemic critically ill patients: it’s time to investigate" pps

... iron. In fact, in just a few hours, proinflammatory and anti-inflammatory cytokines cause a decrease in the iron level in blood. Proinflammatory cytokines such as tumour necrosis factor-α, IL-1β and ... Central Ltd See Review, page 356 Abstract Anaemia is a common problem in critically ill patients admitted to intensive care units. Many factors can be involved in its...

Ngày tải lên: 12/08/2014, 20:20

2 247 0
Báo cáo khoa học: " Is albumin administration in the acutely ill associated with increased mortality? Results of the SOAP study" pps

Báo cáo khoa học: " Is albumin administration in the acutely ill associated with increased mortality? Results of the SOAP study" pps

... regression analysis with albumin administration as the dependent factor. a On the day of onset of albumin administration in the albumin group and on admission in other patients. b At any time during ... plus at least one organ failure. Mean fluid balance was calculated as the total fluid balance during the ICU stay divided by the duration of ICU stay in days. Statistical...

Ngày tải lên: 12/08/2014, 23:20

10 313 0
Báo cáo khoa học: "Etomidate, pharmacological adrenalectomy and the critically ill: a matter of vital importance" pps

Báo cáo khoa học: "Etomidate, pharmacological adrenalectomy and the critically ill: a matter of vital importance" pps

... is educational, in that we need to inform anaesthetic and Emergency Department colleagues regarding current evidence in the critical care literature. There are also implications for clinical researchers. ... partial, as many critically ill patients are intubated by other practitioners [13]. This poses two problems. The first is that clinical and intensive care physicians need to be...

Ngày tải lên: 13/08/2014, 03:20

2 235 0
Báo cáo khoa học: " Oestrone Sulphate Measurements for the Prediction of Small or Large Litters in Pigs" doc

Báo cáo khoa học: " Oestrone Sulphate Measurements for the Prediction of Small or Large Litters in Pigs" doc

... Lan- drace × Duroc boars, used on the day of collection or the day after. All the sows and gilts had been heat tested with a boar also if they were inseminated artificially. Insemination was also ... performed adjacent to a boar. All the sows included had a weaning to service interval of 4 or 5 days. Parity ranged from 1 to 5. Parity and the number of AI or matings were record...

Ngày tải lên: 12/08/2014, 15:20

8 265 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... TCTTTGACTTCTCAAACTGATCG RPE6 5a- His-Fwd NM_200751 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC RPE65c-His-Fwd NM_001113653 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC Y. Takahashi ... GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAG RPE6 5a GSP-...

Ngày tải lên: 14/02/2014, 14:20

14 754 0
Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf

Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf

... expression in female hearts indicates that myocardial glucose metabolism may be increased in parallel. As optimization of glucose metabolism is increasingly highlighted as a therapeutic intervention for ... 3B). Again, these changes were abol- ished in female db ⁄ db heart mitochondria. Together, these data suggest that the greater reliance of female murine cardiac mitochondria...

Ngày tải lên: 18/02/2014, 16:20

7 582 0
w