Báo cáo khoa học: " eal-time ultrasound-guided catheterisation of the internal jugular vein: a prospective comparison with the landmark technique in critical care patients" pot

Báo cáo khoa học: " eal-time ultrasound-guided catheterisation of the internal jugular vein: a prospective comparison with the landmark technique in critical care patients" pot

Báo cáo khoa học: " eal-time ultrasound-guided catheterisation of the internal jugular vein: a prospective comparison with the landmark technique in critical care patients" pot

... was noted that the IJV was overlying the carotid artery rather than being more lateral. To avoid the carotid artery in these cases, a sideway approach of puncturing the IJV was used instead of ... http://ccforum.com/content/10/6/R162 Page 1 of 8 (page number not for citation purposes) Vol 10 No 6 Research eal-time ultrasound-guided catheterisation of the internal...

Ngày tải lên: 13/08/2014, 03:20

8 554 0
Báo cáo khoa học: Unconventional translation initiation of human trypsinogen 4 at a CUG codon with an N-terminal leucine A possible means to regulate gene expression pdf

Báo cáo khoa học: Unconventional translation initiation of human trypsinogen 4 at a CUG codon with an N-terminal leucine A possible means to regulate gene expression pdf

... trypsin 4 with the N-ter- minal isoleucine and intact Isoform B starting with leucine (Fig. 1D). Searching for a protease with potential processing activity in brain extract To demonstrate the absence ... biochemical approach to determine the exact N-terminal sequence of trypsinogen 4, mAbs were raised against human trypsin 4 (obtained by enterokin- ase activation of recom...

Ngày tải lên: 07/03/2014, 10:20

11 469 0
Báo cáo khoa học: "Rapid molecular detection of methicillin-resistant Staphylococcus aureus: a cost-effective tool for infection control in critical care" pdf

Báo cáo khoa học: "Rapid molecular detection of methicillin-resistant Staphylococcus aureus: a cost-effective tool for infection control in critical care" pdf

... unisolated MRSA patient-days avoided, the number of unnecessary pre- emptive isolation days avoided, the increase in the MRSA decolonization rate, the decrease in the MRSA transmission and infection ... Mathematical modeling suggest that using a rapid PCR assay for MRSA admission screening and patient isolation should reduce significantly the incidence of hospital-acquir...

Ngày tải lên: 12/08/2014, 23:22

3 222 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

... hnRNP A1 C UAGACUAGA 5428–5437 ESE2 SC35, SRp40 CCAGUAGAUCCUAGACUAGA 5418–5437 A5 ESE GAR ASF ⁄ SF2, SRp40 GAAGAAGCGGAGACAGCGACGAAGA 5558–5582 [7] A7 ESS3 hnRNP A1 , hnRNP E1 ⁄ E2 AGAUCCAUUCGAUUAG unknown 8047–8062 ... 32] ISS hnRNP A1 UAGUGAAUAGAGUUAGGCAGGGA 7928–7950 ESE3 ASF ⁄ SF2 GAAGAAGAA 8016–8025 hnRNP A1 UAGAAGAAGAA 8018–8025 HIV-1 alternative splicing regulation J. Tazi et al....

Ngày tải lên: 06/03/2014, 09:22

10 434 0
Báo cáo khoa học: G protein-coupled receptor 30 down-regulates cofactor expression and interferes with the transcriptional activity of glucocorticoid pdf

Báo cáo khoa học: G protein-coupled receptor 30 down-regulates cofactor expression and interferes with the transcriptional activity of glucocorticoid pdf

... is independent of the differ- entiation status (normal vs. c ancer) of the epithelial c ells in the mammary gland. We also show here that the abolition of hormone- mediated transactivation of a ... Primer pair 1 resulted in a PCR product of 216 bp. Additionally, forward primer 5¢-GAGCCCC AAGAAGAAAGA-3¢ and reverse primer 5¢- CATCCAAAATCTCC TCCA-3¢ were used. Primer p...

Ngày tải lên: 16/03/2014, 18:20

10 389 0
Báo cáo khoa học: Cytoskeleton-modulating effectors of enteropathogenic and enterohemorrhagicEscherichia coli: a case for EspB as an intrinsically less-ordered effector pptx

Báo cáo khoa học: Cytoskeleton-modulating effectors of enteropathogenic and enterohemorrhagicEscherichia coli: a case for EspB as an intrinsically less-ordered effector pptx

... b-catenin for a- catenin binding, but in fact induces a conformational change in the N-terminal region of a- catenin by bind- ing to the C-terminal region. EspB-bound a- catenin shows enhanced affinity ... the N-terminal vinculin homol- ogy domain of a- catenin [9]. Based on these interactions, it was hypothesized that conformational changes in a- catenin mediated by Esp...

Ngày tải lên: 29/03/2014, 09:20

7 333 0
Báo cáo khoa học: Anti-arthritis effects of vitamin K2 (menaquinone-4) ) a new potential therapeutic strategy for rheumatoid arthritis doc

Báo cáo khoa học: Anti-arthritis effects of vitamin K2 (menaquinone-4) ) a new potential therapeutic strategy for rheumatoid arthritis doc

... chain whereas vitamin K 2 has an unsaturated side chain [1]. Vitamin K 2 acts as a cofactor for a vitamin K- dependent carboxylase involved in the carboxylation of coagulation factors and is an ... vitamin K 2 (MK-4). The inhibitory effect of vitamin K 2 and vitamin K 1 was evaluated with the MTT assay. The level of the absorbance in the MTT assay from untreated ce...

Ngày tải lên: 30/03/2014, 03:20

7 455 0
Báo cáo khoa học nông nghiệp " CARD Project 030/06 VIE: Developing a strategy for enhancing the competitiveness of rural small and medium enterprises in the agro-food chain: the case of animal feed " pptx

Báo cáo khoa học nông nghiệp " CARD Project 030/06 VIE: Developing a strategy for enhancing the competitiveness of rural small and medium enterprises in the agro-food chain: the case of animal feed " pptx

... On management of Melamine in animal husbandry and aquaculture. The decision prohibits the import, production and use of materials and animal feed contaminated with melamine. The acceptable ... 5 • Ministry of Planning and Investment, • National Institute of Animal Husbandry (NIAH), and • National Institute of Veterinary Research. Implementation of Policy In cont...

Ngày tải lên: 21/06/2014, 05:20

27 548 0
Báo cáo khoa học: "Growth and morphology of pedunculate oak (Quercus robur L) and beech (Fagus sylvatica L) seedlings in relation to shading and drought" docx

Báo cáo khoa học: "Growth and morphology of pedunculate oak (Quercus robur L) and beech (Fagus sylvatica L) seedlings in relation to shading and drought" docx

... larger biomass partitioning to the root, prima- rily at the expense of the stem and branches. The additional investment in the root system while maintaining the capacity ... of the- se shelters were covered with green nets that intercepted 35 and 65% of the incoming radia- tion. The plastic roofings gave an additional re- duction i...

Ngày tải lên: 08/08/2014, 18:21

10 308 0
Báo cáo khoa học: "Consequential late effects after radiotherapy for prostate cancer - a prospective longitudinal quality of life study" pps

Báo cáo khoa học: "Consequential late effects after radiotherapy for prostate cancer - a prospective longitudinal quality of life study" pps

... was also associated with a significant increase in late gastrointestinal toxicity [9,10]. In the early years of radiotherapy, the “skin erythema dose” was used for the definition of tolerable doses. During ... in the past, based on a grading system [ 12,13], a quality of life ana- lysis was used to elaborate the impact of consequential Table 1 Demographic and t...

Ngày tải lên: 09/08/2014, 08:23

9 303 0
w