Báo cáo khoa học: "Epidemiology and clinical outcome of virus-positive respiratory samples in ventilated patients: a prospective cohort study" pptx

Báo cáo khoa học: "Epidemiology and clinical outcome of virus-positive respiratory samples in ventilated patients: a prospective cohort study" pptx

Báo cáo khoa học: "Epidemiology and clinical outcome of virus-positive respiratory samples in ventilated patients: a prospective cohort study" pptx

... lower respiratory tract was associated with clinical signs of acute COPD exacerbation, of pneumonia or of pulmonary edema in all cases except in four patients, and virus influenza was associated ... with acute respiratory or cardiac failure in all cases but one. Viral coinfection was detected in four patients: one case of rhinovirus and virus parainfluenza 3, one c...

Ngày tải lên: 13/08/2014, 03:20

10 195 0
Báo cáo khoa học: "Prevalence and Clinical Characterization of Gastric Helicobacter Species Infection of Dogs and Cats in Korea" pps

Báo cáo khoa học: "Prevalence and Clinical Characterization of Gastric Helicobacter Species Infection of Dogs and Cats in Korea" pps

... (bp) C97 5 ′ -GCTATGACGGGTATCC- 3 ′ 400 C98 5 ′ -GATTTTACCCCTACACCA- 3 ′ H. felis F, 5 ′ -ATGAAACTAACGCCTAAAGAACTAG 1,150 R, 5 ′ -GGAGAGATAAAGTGAATATGCGT H. pylori F, 5 ′ -GGAATTCCAGATCTATGAAAAAGATTAGCAGAAAAG- ... 5 ′ -GGAATTCGTCGACCTAGAAAATGCTAAAGAGTTG- 3 ′ H. heilmannii F, 5 ′ -GGGCGATAAAGTGCGCTTG- 3 ′ 580 R, 5' -CTGGTCAATGAGAGG- 3 ′ a F, forward; R, reverse. Cloning and nucleotide...

Ngày tải lên: 07/08/2014, 15:20

11 301 0
Báo cáo khoa học: Protein and mRNA content of TcDHH1-containing mRNPs in Trypanosoma cruzi pdf

Báo cáo khoa học: Protein and mRNA content of TcDHH1-containing mRNPs in Trypanosoma cruzi pdf

... proteins, mRNA- binding proteins, initiation and elongation translation factors, ribosomal proteins and metabolic proteins. Abundant proteins, such as heat shock proteins and elongation factor 1a, ... v.3.5.2 program (Kodak, Rochester, NY, USA). The ratio of the densitometric values of the bands containing amplified cDNA between IP and SP samples was determined. Acknowledgements...

Ngày tải lên: 15/03/2014, 23:20

12 481 0
Báo cáo khoa học: Biochemical and structural characterization of mammalian-like purine nucleoside phosphorylase from the Archaeon Pyrococcus furiosus pptx

Báo cáo khoa học: Biochemical and structural characterization of mammalian-like purine nucleoside phosphorylase from the Archaeon Pyrococcus furiosus pptx

... guan- ine were 10.5 min and 4.7 min, and 11.5 min and 4.3 min, respectively. The amount of purine base formed is deter- mined by measuring the percentage of the absorbance integrated peak area ... thermostability was tested by incubating the pro- tein in sealed glass vials at temperatures between 100 °C and 115 °C in an oil bath. Samples (2 lg) were taken at time intervals...

Ngày tải lên: 23/03/2014, 09:21

14 384 0
báo cáo khoa học: "Incidence and clinicopathologic behavior of uterine cervical carcinoma in renal transplant recipients" potx

báo cáo khoa học: "Incidence and clinicopathologic behavior of uterine cervical carcinoma in renal transplant recipients" potx

... carcinoma followed by cervical carcinoma and bladder carcinoma. (Table 1). Clinicopathological analysis of cervical carcinoma that developed after a renal transplant The mean age at the time of ... with accumulated genetic variations [8,9]. In South Korea, statistical data on a national level on the incidence of malignancy in patients who had received a renal transplant are...

Ngày tải lên: 09/08/2014, 02:20

6 350 0
Báo cáo khoa học: "Evaporation and surface conductance of three temperate forests in the Netherlands" pdf

Báo cáo khoa học: "Evaporation and surface conductance of three temperate forests in the Netherlands" pdf

... maximum values of variables are shown. This gives an indi- cation of the statistical variation in the data, and allows a qualitative assessment of the main functional relationships ... which calculated on-line vari- ances and co-variances at half hourly inter- vals using an moving average filter with a time constant of 200 s. An automa...

Ngày tải lên: 09/08/2014, 04:20

16 355 0
báo cáo khoa học: " Identification and comparative analysis of drought-associated microRNAs in two cowpea genotypes" docx

báo cáo khoa học: " Identification and comparative analysis of drought-associated microRNAs in two cowpea genotypes" docx

... IT93K503- Control IT93K503- Drought CB46- Control CB46- Drought Putative Target vun_cand058 UUAAGCAGAAUGAUCAAAUUG 942 1546 3 0 hydroxyproline-rich glycoprotein vun_cand048 UGGUCUCUAAACUUUAGAAAUGAA 746 263 0 2 vun_cand036 UCAGAGGAAACAACACUUGUAC 59 23 ... 0 vun_cand045 CGUGCUGAGAAAGUUGCUUCU 52 79 14 5 VTC2 (vitamin c defective 2) vun_cand053 GUAAUUGAGUUAAAAGGACUAUAU 43 6 0 2 cellulose synthase/...

Ngày tải lên: 11/08/2014, 11:21

11 391 0
báo cáo khoa học: " Trust and the regulation of pharmaceuticals: South Asia in a globalised world" ppt

báo cáo khoa học: " Trust and the regulation of pharmaceuticals: South Asia in a globalised world" ppt

... the manuscript. NR and MS were partners in the data collection in Nepal. SMR was a partner in the data collection and analysis of material from India. All authors read and approved the final manuscript. Competing ... is an increasingly significant pharmaceuticals mar- ket, although the vast majority of pharmaceuticals avail- able in India are already off patent, and gene...

Ngày tải lên: 11/08/2014, 14:21

13 361 0
Báo cáo khoa học: "Factors that predict outcome of intensive care treatment in very elderly patients: a review" potx

Báo cáo khoa học: "Factors that predict outcome of intensive care treatment in very elderly patients: a review" potx

... participated in prepar- ing the manuscript. SEdR interpreted data and participated in preparing the manuscript. AA-H analyzed and interpreted data. ML interpreted data. All authors read and approved ... Amsterdam 2 Adjunct Head, Department of Medical Informatics, Academic Medical Center, University of Amsterdam, Amsterdam 3 Professor and Head, Department of Internal Medicine...

Ngày tải lên: 12/08/2014, 22:21

8 281 0
báo cáo khoa học: " Barriers and facilitators to implementing shared decision-making in clinical practice: a systematic review of health professionals'''' perceptions" ppt

báo cáo khoa học: " Barriers and facilitators to implementing shared decision-making in clinical practice: a systematic review of health professionals'''' perceptions" ppt

... University of Ottawa, Ottawa, Canada Email: Karine Gravel - karine.gravel@crsfa.ulaval.ca; France Légaré* - france.legare@mfa.ulaval.ca; Ian D Graham - igraham@ohri.ca * Corresponding author Abstract Background: ... Edwards A, Elwyn G: Involving patients in decision making and communicating risk: a longitudinal evaluation of doctors' attitudes and confidence during a rand...

Ngày tải lên: 11/08/2014, 05:22

12 390 0
Từ khóa:
w