Báo cáo khoa học: "The early responses of VEGF and its receptors during acute lung injury: implication of VEGF in alveolar epithelial cell survival" ppt

Tài liệu Báo cáo khoa học: The heat shock factor family and adaptation to proteotoxic stress pdf

Tài liệu Báo cáo khoa học: The heat shock factor family and adaptation to proteotoxic stress pdf

... heat shock factor family and adaptation to proteotoxic stress Mitsuaki Fujimoto and Akira Nakai Yamaguchi University School of Medicine, Ube, Japan Introduction All living organisms respond to ... as heat shock proteins (HSP) [1]. This response is called the heat shock response, and is a universal mechanism of protection against proteotoxic stress, includ...

Ngày tải lên: 18/02/2014, 04:20

14 688 0
Tài liệu Báo cáo khóa học: The unusual methanogenic seryl-tRNA synthetase recognizes tRNASer species from all three kingdoms of life pptx

Tài liệu Báo cáo khóa học: The unusual methanogenic seryl-tRNA synthetase recognizes tRNASer species from all three kingdoms of life pptx

... The pI of IEF protein standards are indicated on the left. 696 S. Bilokapic et al. (Eur. J. Biochem. 271) Ó FEBS 2004 The unusual methanogenic seryl-tRNA synthetase recognizes tRNA Ser species from ... while the number of unpaired nucleotides at the base of variable arm reflects the similarity to eukaryotic tRNAs, due to the presence of at least one unpaire...

Ngày tải lên: 19/02/2014, 12:20

9 341 0
Tài liệu Báo cáo khoa học: The SCO2299 gene from Streptomyces coelicolor A3(2) encodes a bifunctional enzyme consisting of an RNase H domain and an acid phosphatase domain pdf

Tài liệu Báo cáo khoa học: The SCO2299 gene from Streptomyces coelicolor A3(2) encodes a bifunctional enzyme consisting of an RNase H domain and an acid phosphatase domain pdf

... to encode a bifunctional enzyme consisting of an RNase H domain and an APase domain. The RNase H and APase activities of the full length SCO2299 protein depend on its N-terminal RNase H domain and C-ter- minal ... protein also exhib- ited acid phosphatase activity at almost the same level as the C-terminal domain alone. These results indi...

Ngày tải lên: 19/02/2014, 18:20

10 561 1
Tài liệu Báo cáo khoa học: The small heat shock proteins and their role in human disease pptx

Tài liệu Báo cáo khoa học: The small heat shock proteins and their role in human disease pptx

... gliosis and expression of the small heat Y. Sun and T. H. MacRae Small heat shock proteins and disease FEBS Journal 272 (2005) 26132627 ê 2005 FEBS 2625 recognition and initiating internal signaling ... antiapoptotic potential and decrease cell protection by Hsp25. In another example, Hsp27 and aB-crystallin appear in Parkinson’s disease Y. Sun and T. H. M...

Ngày tải lên: 19/02/2014, 18:20

15 573 0
Báo cáo khoa học: Isoquinoline-1,3,4-trione and its derivatives attenuate b-amyloid-induced apoptosis of neuronal cells pdf

Báo cáo khoa học: Isoquinoline-1,3,4-trione and its derivatives attenuate b-amyloid-induced apoptosis of neuronal cells pdf

... inhibition of caspase-3 activity can block induction of apoptosis by Ab in primary neuronal cells and PC12 cells [14]. The neurotoxicity of Ab seems to depend on its ability to aggregate, and the ... we validated isoquinoline-1,3,4-trione and its derivatives as selective, irreversible, slow-binding, pan-caspase inhibitors. This compound and its derivatives pr...

Ngày tải lên: 07/03/2014, 11:20

11 388 0
Báo cáo khoa học: The twin-arginine translocation (Tat) systems from Bacillus subtilis display a conserved mode of complex organization and similar substrate recognition requirements doc

Báo cáo khoa học: The twin-arginine translocation (Tat) systems from Bacillus subtilis display a conserved mode of complex organization and similar substrate recognition requirements doc

... RTEAyF (5Â-CGCGTCTCGCATGCCGATCGGTCCTGGAAGCCT TGCTG-3Â) and JJystrep02 (5Â-ATATTCTAGATTA TTT TTCAAACTGTGGGTGCGACCAATTCGATTGCCCAG AAGACACGTCCCG-3Â). RTEAyF was designed as such that restriction of the generated tatAyCy–strep ... relevance for the biological roles of the TatAdCd and TatAyCy systems in B. subtilis. Here, we have shown that both the TatAdCd and TatAyCy syste...

Ngày tải lên: 16/03/2014, 04:20

12 445 0
Báo cáo khoa học: The bI/bIII-tubulin isoforms and their complexes with antimitotic agents pptx

Báo cáo khoa học: The bI/bIII-tubulin isoforms and their complexes with antimitotic agents pptx

... with the ligand, notwith- standing the shift in the ligand position with respect to the E1 complex. Due to the described differences between the two binding modes, the interactions invol- ving the ... with Arg320. The models of the complexes of IDN5390 with the bI and bIII-tubulin isoforms are shown in Fig. 5. The bound conformation of the ligand is qui...

Ngày tải lên: 16/03/2014, 13:20

10 454 0
Báo cáo khoa học: The Rab5 effector Rabaptin-5 and its isoform Rabaptin-5d differ in their ability to interact with the small GTPase Rab4 doc

Báo cáo khoa học: The Rab5 effector Rabaptin-5 and its isoform Rabaptin-5d differ in their ability to interact with the small GTPase Rab4 doc

... therefore used this assay to analyze the interaction of Rabaptin-5d with Rab4 and Rab5. Similarly to Rabaptin-5, Rabaptin-5d was not able to bind Rab4 or Rab5 in the inactive, GDP-bound form as ... August 2004) doi:10.1111/j.1432-1033.2004.04399.x Rabaptin-5 is an effector for the small GTPase Rab5, a regulator of the early steps in endocytosis. In...

Ngày tải lên: 16/03/2014, 18:20

10 411 0
Báo cáo khoa học: The b-N-acetylglucosaminidases NAG1 and NAG2 are essential for growth of Trichoderma atroviride on chitin doc

Báo cáo khoa học: The b-N-acetylglucosaminidases NAG1 and NAG2 are essential for growth of Trichoderma atroviride on chitin doc

... D nag2- I and Dnag2-II are Dnag2 strains C2332 and A523, and nag1Dnag2-I and nag1Dnag2-II are Dnag1Dnag2 strains 713 and 1921, respectively. NAG1 and NAG2 are essential for growth on chitin and ... in comparison to the parental strain [23]. Chitinase formation on chitin plates was reduced in the Dnag1 strain but not in the Dnag2 and Dnag1Dnag2 C...

Ngày tải lên: 23/03/2014, 05:22

12 457 0
Báo cáo khoa học: The relationship between thermal stability and pH optimum studied with wild-type and mutant Trichoderma reesei cellobiohydrolase Cel7A ppt

Báo cáo khoa học: The relationship between thermal stability and pH optimum studied with wild-type and mutant Trichoderma reesei cellobiohydrolase Cel7A ppt

... The relationship between thermal stability and pH optimum studied with wild-type and mutant Trichoderma reesei cellobiohydrolase Cel7A Harry Boer and Anu Koivula VTT Biotechnology, ... 8.0 and 25 °C. Spectra of the wild-type Cel7A at pH 5.8 (d) and pH 8.0 (s), and the pH mutant at pH 5.8 (j) and pH 8.0 (h) were recorded from 240...

Ngày tải lên: 31/03/2014, 07:20

8 422 0
Báo cáo khoa học: "The Merendino procedure following preoperative imatinib mesylate for locally advanced gastrointestinal stromal tumor of the esophagogastric junction" ppsx

Báo cáo khoa học: "The Merendino procedure following preoperative imatinib mesylate for locally advanced gastrointestinal stromal tumor of the esophagogastric junction" ppsx

... Oncology Open Access Case report The Merendino procedure following preoperative imatinib mesylate for locally advanced gastrointestinal stromal tumor of the esophagogastric junction Wilko I ... with a locally advanced GIST of the GEJ who was first treated by imatinib mesylate followed by tumor removal with limited resection and interposition of...

Ngày tải lên: 09/08/2014, 07:21

6 325 0
Báo cáo khoa học: " The radiosensitizer 2-benzoyl-3-phenyl-6,7-dichloroquinoxaline 1,4-dioxide induces DNA damage in EMT-6 mammary carcinoma cells" potx

Báo cáo khoa học: " The radiosensitizer 2-benzoyl-3-phenyl-6,7-dichloroquinoxaline 1,4-dioxide induces DNA damage in EMT-6 mammary carcinoma cells" potx

... accu- mulation induced by IR appear together in combination treatments. Despite our intriguing findings that the com- bination treatment DCQ+IR induces DNA damage, including DSBs, and slows repair, the ... Topoisomerase II inhibitor mitoxantrone [17]. Another major kinase activated by DNA damage is DNA- PK, which is activated by binding to the damaged sites on DNA [18]....

Ngày tải lên: 09/08/2014, 10:20

10 274 0
báo cáo khoa học: " The buccal minor salivary glands as starting point for a metastasizing adenocarcinoma – report of a case" pptx

báo cáo khoa học: " The buccal minor salivary glands as starting point for a metastasizing adenocarcinoma – report of a case" pptx

... Central Page 1 of 5 (page number not for citation purposes) Head & Face Medicine Open Access Case report The buccal minor salivary glands as starting point for a metastasizing adenocarcinoma ... in immunohistochemistry. Conclusion: A rare case of an adenocarcinoma (NOS) of the minor salivary glands with a rapid development and an unfavourabl...

Ngày tải lên: 11/08/2014, 20:20

5 338 0
Báo cáo khoa học: "The early responses of VEGF and its receptors during acute lung injury: implication of VEGF in alveolar epithelial cell survival" ppt

Báo cáo khoa học: "The early responses of VEGF and its receptors during acute lung injury: implication of VEGF in alveolar epithelial cell survival" ppt

... 5 Research The early responses of VEGF and its receptors during acute lung injury: implication of VEGF in alveolar epithelial cell survival Marco Mura, Bing Han, Cristiano F Andrade, Rashmi ... release of VEGF, and the expression and distribution of VEGF and its receptors in the lung during the early onset of ALI induced by intest...

Ngày tải lên: 13/08/2014, 03:20

13 290 0
Báo cáo y học: "Danaparoid sodium inhibits systemic inflammation and prevents endotoxin-induced acute lung injury in rats" doc

Báo cáo y học: "Danaparoid sodium inhibits systemic inflammation and prevents endotoxin-induced acute lung injury in rats" doc

... significantly improved acute lung injury and mortal- ity in a rat model. Acute lung injury is characterised by non- cardiogenic oedema, pulmonary inflammation and severe sys- temic hypoxemia. Many sequelae ... [14,15]. We hypothesised that DA would act as an inhibitor of systemic inflammation and prevent acute lung injury in a rat model. To ALI = acute lun...

Ngày tải lên: 13/08/2014, 08:21

8 276 0
Từ khóa:
w