Báo cáo khoa học: "SOFA is superior to MOD score for the determination of non-neurologic organ dysfunction in patients with severe traumatic brain injury: a cohort study" doc

... Hirashima Y, Nakamura S, Endo S, Kuwayama N, Naruse Y, Takaku A: Elevation of platelet activating factor, inflammatory cytokines, and coagulation factors in the internal jugular vein of patients ... cardiovascular failure is a poor discriminator of outcome rather than SOFA overcalling cardiovascular failure due to vasopressor use for cerebrovas- cular support. In genera...

Ngày tải lên: 13/08/2014, 02:24

... to isolate the effect of each variate independently of the other (Adjusted for baseline risk of death and for each other). Finally, the hazard ratio associated with hypernatremia was estimated ... confounding factors (Crude analysis), and after adjusting for baseline risk (Adjusted for baseline risk of death). They were then estimated including hypernatremia and DD...

Ngày tải lên: 13/08/2014, 16:21

... Ballerini A, Baccalon RM, Boncompagni G, Casacchia M, Margari F, Minervini L, et al: Main clinical features in patients at their first psychiatric admission to Italian acute hospital psychiatric ... 1478, Norway. Authors’ contributions AB: collecting data, analysis, drafting and revising the manuscript. OAA: conception of the study, collecting data, analysis, drafting and revisin...

Ngày tải lên: 11/08/2014, 15:22

... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3rev- Gulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT A- 3¢. ... corresponding a- ketoacids in the pathway for branched-chain amino acids [45]. These observations suggest that L-AA could act in M. tuberculosis as a modulator of...

Ngày tải lên: 07/03/2014, 12:20

... preparation The JEV isolate KV1899, Anyang 300 (attenuated vaccine strain) and Nakayama strain were used as standard virus for detection of JEV by real-time RT-PCR. The KV1899 and Anyang 300 strains ... quencher at the 3' end to monitor accumulation of PCR products [4]. In this study, a real-time RT-PCR assay with TaqMan probe was investigated and applied for labora...

Ngày tải lên: 07/08/2014, 18:20

... apical staining of this marker was apparent in distinct areas of 3-D Huh7 aggregates (Fig. 3). Taken together, these data demonstrate that the expres- sion and distribution of cell adhesion and TJ ... [2]. RNA isolation and RTqPCR Total cellular RNA was isolated by the guanidine thiocy- anate method using standard protocols [29]. One μg of RNA was used for cDNA synthesis using...

Ngày tải lên: 12/08/2014, 04:21

... apical staining of this marker was apparent in distinct areas of 3-D Huh7 aggregates (Fig. 3). Taken together, these data demonstrate that the expres- sion and distribution of cell adhesion and TJ ... 369:583-591. 34. Kamiya A, Kinoshita T, Ito Y, Matsui T, Morikawa Y, Senba E, Nakashima K, Taga T, Yoshida K, Kishimoto T, Miyajima A: Fetal liver development requires a paracrine...

Ngày tải lên: 12/08/2014, 04:22

... as visualized by cluster analysis with self- organizing maps. Crit Care Med 2004, 32:2428-2436. 18. Kato T, Nakayama N, Yasokawa Y, Okumura A, Shinoda J, Iwama T: Statistical image analysis of ... resulted in a total of 58,794 values in all patients and an average of 258 values per patient. Values assessed at 4-hour intervals or once daily were used to determine changes in...

Ngày tải lên: 13/08/2014, 11:22

... < 0.001). Administration of insulin at brain glucose less than 5 mM (the threshold determined in Figure 5) was associated with a significant increase in brain glutamate (Figure 6a) and unchanged brain ... data, performed graphical and statistical analysis, and drafted parts of the manuscript. All authors have read and approved the final manuscript. Acknowledgements...

Ngày tải lên: 13/08/2014, 20:21

... factor as a non-invasive marker of pulmonary vascular remodeling in patients with bronchitis-type of COPD Hiroshi Kanazawa*, Kazuhisa Asai and Saeko Nomura Address: Department of Respiratory ... KA participated in the analysis and inter- pretation of data, technical support, and critical revision of the manuscript. SN participated in the analysis and interpretati...

Ngày tải lên: 12/08/2014, 15:20