Báo cáo y học: "Nef-mediated enhancement of cellular activat

Báo cáo y học: "Nef-mediated enhancement of cellular activation and human immunodeficiency virus type 1 replication in primary T cells" docx

... examine the ability of Nef to associate with SH3 domain-containing cellular factors that i nfluence both PAK2 association and T cell activation. This interaction is an attractive potential therapeutic ... therapeutic target because an inhibitor that blocks the ability of Nef to interact with host cell f actors important for enhancement of H IV -1 replication and T cell...

Ngày tải lên : 13/08/2014, 01:21

17
239
0

Báo cáo y học: " Coordinate enhancement of transgene transcription and translation in a lentiviral vector" pps

... primers (5'TTTTTATCGATAAGCTCAATATTGGCCATATTATTCAT TGG3' and 5'TTTTCATATGCAGTTGTTACGACATTTTGGAAAG3') and ligated with NdeI-ClaI-digested PCE-Luc and U3-Luc in order to create IE-PCE-Luc and IE-U3-Luc, ... found that binding of histone deacetylase enzyme HDAC1 to the LTR of an HIV -1 provirus induced altera- tions in the chromatin structure that disrupted bi...

Ngày tải lên : 13/08/2014, 09:21

10
325
0

Báo cáo y học: "The influence of serum, glucose and oxygen on intervertebral disc cell growth in vitro: implications for degenerative disc disease" potx

... ↔ Cell death ↔↔↔↔ Collagen synthesis ↑↑↑ Type I ↓ Type II ↔ Type I ↔ Type II ↔ Type I ↔ Type II ↓↓↓ Type I ↓ Type II Serum Glucose Alginate With Without With Without Cell proliferation ↓↓ ↓↓↓ ... deprivation, but not serum or oxygen deprivation, inhibited synthesis of type I and type II collagen, both in monolayer and alginate cultures. Conclusion This study demons...

Ngày tải lên : 09/08/2014, 10:23

8
324
0

Báo cáo y học: "RNA interference of argininosuccinate synthetase restores sensitivity to recombinant arginine deiminase (rADI) in resistant cancer cells" pps

... cell lines deficient in argininosuccinate synthetase are sensitive to arginine deprivation by arginine deiminase. Int J Cancer 2008, 12 3 :19 50 -19 55. doi :10 .11 86 /14 23- 012 7 -18 -25 Cite this article ... 18 :25 http://www.jbiomedsci.com/content /18 /1/ 25 Page 10 of 11 MCF-7 cells in the presence of rADI treatment. The cell cycle patterns of EGFP-transduced MCF-7 cells...

Ngày tải lên : 10/08/2014, 05:21

11
313
0

Báo cáo sinh học: " Streamlined design of a self-inactivating feline immunodeficiency virus vector for transducing ex vivo dendritic cells and T lymphocytes" ppsx

... se minimally dependent on this motif Transduction of primary murine DCs and T lymphocytes with LAW34/VSV-G and LAW34/RD 114 /TRFigure 7 Transduction of primary murine DCs and T lymphocytes with ... (LAW34/RD 114 /TR; Fig. 6A) was titrated for TU in the same cell substrate using the ultracentrifugation and the PB/DT protocols. Again, in spite of a three-fold increme...

Ngày tải lên : 14/08/2014, 19:22

13
277
0

Báo cáo y học: "Systematic profiling of cellular phenotypes with spotted cell microarrays reveals mating-pheromone response genes" pot

... as regulatory functions (the histone deacetylase SDS3 and the ubiquitin protein ligase UBR2 ). We separately validated the BNI1 and UBR2 involvement by reconstructing and retesting the deletion strains. ... clearly differentiated from the normally shmooing strains in this assay (Figure 3), except for those deleted for five inhib- itors of the pathway that arrest growth strongly in...

Ngày tải lên : 14/08/2014, 16:20

9
273
0

Báo cáo y học: "A Comparison of Immuncapture Agglutination and ELISA Methods in Serological Diagnosis of Brucellosis"

... an effect on the sensitivity, specificity and ultimately applicability of the method (12 ,14 ). ELISA tests are relatively costlier tests in comparison to agglutination tests that require ... tests. Ig M and G type antibodies that form against this structure are identi- fied through agglutination tests. ELISA test which is among these tests and makes it possible to determi...

Ngày tải lên : 25/10/2012, 10:56

5
604
0

Báo cáo y học: "The association of meat intake and the risk of type 2 diabetes may be modified by body weight"

... data on associations between total meat and type of meat intake and the risk of type 2 DM are inconsistent and limited [3]. Total meat intake was associated with a higher risk of diabetes in ... independent of this Western dietary pattern [5;6]. Our study offers a unique opportunity to investigate associations between meat intake and the risk of type 2 DM with...

Ngày tải lên : 31/10/2012, 16:49

8
701
0

Báo cáo y học: "Comparative study of serum Na+ and K+ levels in senile cataract patients and normal individuals"

... Department of Biochemistry and Nutrition in Iran University of Medical Sciences. He is interested in study of nutrition and trace elements in human blood. Manuchehr Imamian obtained BSc in Chemistry ... Journal of Clinical Nutrition. 19 96; 63: 985- 990. 17 . Claytone RM, Culthbert J, et al. Some risk factor associated with cataract in Scotland. A pilot study. Tra...

Ngày tải lên : 03/11/2012, 09:49

5
611
1

Tài liệu Báo cáo Y học: The structures of the lipooligosaccharide and capsule polysaccharide of Campylobacter jejuni genome sequenced strain NCTC 11168 pdf

... ampliﬁed with: glfF10 81 (5¢-TTTTACAAAATAATAATGCCGATCT-3¢) and glfR6 (5¢-TGATTATTTAATTGTTGGTTCTGG A-3¢). The PCR products were ligated to pPCR-Script Amp according to the manufacturer’s instructions. ... strain C. jejuni NCTC 11 168. The outer core LOS of NCTC 11 168 has structural homology with the human gangliosides, GM2 and GM1a. As demonstrated previously in NCTC 11 168 [16...

Ngày tải lên : 21/02/2014, 01:21

18
718
0